Words similar to active
- actgtg
- actgtggctactcagctgtg-
- acth
- action
- actions
- activated
- activates
- activating
- activation
- activations
- activationâ
- activator
- activators
- activats
- active
- active-control
- active-controlled
- active-duty
- active-site
- actively
- activeperl
- actives
- activestate
- activex
- activities
- activity
- activity-based
- actr
- actttggatcattctatgcag
Example sentences for: active
How can you use “active” in a sentence? Here are some example sentences to help you improve your vocabulary:
The variability of gene expression across clonal cell strains with the same genotype and the same X chromosome active was similar among clones expressing the mutant or the wild-type MECP2 allele.
Second, since the Neo 3' splice site is downstream of the NPT initiation codon, its use may skew the targeting to favor of those genes capable of splicing upstream exons in-frame, to produce enzymatically active fusion proteins.
To avoid this, CAP in micronized form (which does not aggregate at low pH), instead of CAP in soluble form is being considered as a topical microbicide [ 30 31 32 33 34 35 ] . Micronized CAP (Aquateric) was shown to be virucidal against HIV-1, herpesviruses and several nonviral sexually transmitted disease (STD) pathogens [ 30 31 32 33 34 ] . The virucidal activity of micronized CAP could at least partly be explained by its buffering capacity at low pH [ 40 ] since it is a free acid while other anionic polymeric microbicide candidates (except BufferGel, the active ingredient of which is Carbomer 974P [ 27 ] ) are sodium salts.
All patients had long-standing, active RA.
Great reviews for this Eddie Murphy-Steve Martin comedy about a low-rent movie-maker (Martin) and his ragtag stable of actors: "Perhaps the funniest movie for grownups so far this year" (Richard Schickel, Time ). Martin, out of desperation, hires a painfully awkward nerd (Murphy) who has no film experience other than being "an active renter at Blockbuster" but who bears a striking resemblance to action star Kit Ramsey (also played by Murphy).
Loading...