Words similar to active
- actgtg
- actgtggctactcagctgtg-
- acth
- action
- actions
- activated
- activates
- activating
- activation
- activations
- activationâ
- activator
- activators
- activats
- active
- active-control
- active-controlled
- active-duty
- active-site
- actively
- activeperl
- actives
- activestate
- activex
- activities
- activity
- activity-based
- actr
- actttggatcattctatgcag
Example sentences for: active
How can you use “active” in a sentence? Here are some example sentences to help you improve your vocabulary:
The functions of Boi1/Boi2 appear to be linked to those of Cdc42 and Rho3, which are Rho-type GTPases that are important for polarized cell growth [ 4 5 6 7 8 9 ] . Boi1 and Boi2 display two-hybrid interactions with both wild-type and mutationally activated Cdc42 but not with a mutant version of Cdc42 that is predicted to be impaired in the ability to bind nucleotide, suggesting that Boi1 and Boi2 may associate with the GTP-bound ("active") form of Cdc42 [ 1 ] . Further evidence that some function of Boi1 is linked to that of Cdc42 is that overexpression of Boi1 inhibits bud emergence and that this inhibition can be suppressed by overexpression of Cdc42 [ 1 2 ] . RHO3 can serve as a multicopy suppressor of the lethality caused by deletion of BOI1 and BOI2 [ 1 2 ] . These findings are consistent with the possibilities that Boi1 and Boi2 are targets of Cdc42 that promote cell growth in a manner that is regulated by Rho3.
The active compounds exhibited very low to moderate toxicity in assays for their effects on cell viability (Table 2).
For instance, smoking cessation, which can be viewed as a form of active intervention, appears to result in a decrease of metaplasia rates from 27% in active smokers to 7% in former smokers [ 7].
The current method for discriminating between active and latent TGF-β in tissue samples requires the use of frozen sections and immunofluorescence techniques, which are not practical for routine clinical use [ 36].
The study of the emergence of complexity is one of the most active and important areas of research.
Loading...