Words similar to active
- actgtg
- actgtggctactcagctgtg-
- acth
- action
- actions
- activated
- activates
- activating
- activation
- activations
- activationâ
- activator
- activators
- activats
- active
- active-control
- active-controlled
- active-duty
- active-site
- actively
- activeperl
- actives
- activestate
- activex
- activities
- activity
- activity-based
- actr
- actttggatcattctatgcag
Example sentences for: active
How can you use “active” in a sentence? Here are some example sentences to help you improve your vocabulary:
The NYT lead reports a striking fact: more Army reservists have been called up for active duty in Bosnia than were called up during all of Vietnam, and the episode marks the first time in nearly thirty years that a National Guard combat unit has been shipped overseas.
The 3' arm of homology contains 1.8 kb of the human hprt gene that includes exon1 and 2.9 kb of mouse genomic sequence that includes exon 2 (fig 3a) as described previously [ 15 ] . Homologous recombination at the modified hprt locus in F3 cells should substitute genomic DNA containing hprt exons 1 and 2 for neo thereby reconstituting a gene encoding active Hprt (fig 3a).
Similarly, the inhibitory effect of the antiandrogen on AR was not prevented by the presence of constitutively active Stat3C.
Active caspase-3 is a functional requirement of spontaneous luteal regression in that caspase-3-deficient mice retain CL for a longer period of time than wild type littermates [ 47 ] . However, this murine study did not delineate which luteal cells were affected.
The relative potencies of the most active derivatives - 1.2, 1.3, 1.4 and 1.5 - are shown in Figure 1d.