Words similar to active
- actgtg
- actgtggctactcagctgtg-
- acth
- action
- actions
- activated
- activates
- activating
- activation
- activations
- activationâ
- activator
- activators
- activats
- active
- active-control
- active-controlled
- active-duty
- active-site
- actively
- activeperl
- actives
- activestate
- activex
- activities
- activity
- activity-based
- actr
- actttggatcattctatgcag
Example sentences for: active
How can you use “active” in a sentence? Here are some example sentences to help you improve your vocabulary:
Taken together, these data indicate that inducible PP1α is biochemically active.
Identification of four introns (Figure 1) and complete complementation of the rec12-117 hyporecombination defect by the full-length cDNA (Figure 2) confirmed that Rec12 protein is homologous to Spo11 of other eukaryotes [ 11 ] . Both Rec12 and its active site tyrosine are required for intragenic and intergenic recombination at multiple locations on all three chromosomes (Figure 2, Tables 1, 2, data not shown).
TNapS and TAnthS were more active against the IHD-J than WR strain (Table 1) using CV-1 cells.
All of these genes are relatively repressed on the paternal allele and active on the maternal allele.
The morphological differences in alphaA/BKO lenses, compared to age matched wild type lenses, were consistent with the hypothesis that alpha-crystallin plays an active role in the differentiation and growth of lens fiber cells.