Words similar to active
- actgtg
- actgtggctactcagctgtg-
- acth
- action
- actions
- activated
- activates
- activating
- activation
- activations
- activationâ
- activator
- activators
- activats
- active
- active-control
- active-controlled
- active-duty
- active-site
- actively
- activeperl
- actives
- activestate
- activex
- activities
- activity
- activity-based
- actr
- actttggatcattctatgcag
Example sentences for: active
How can you use “active” in a sentence? Here are some example sentences to help you improve your vocabulary:
The original active molecule, Hh-Ag 1.1, stimulated thymidine incorporation at 5 μM, but not at 1.75 μM (Figure 1f).
No consistent differences were detected in the levels of intracellular or secreted, latent or active TGFβ1 (data not shown).
The high-scoring segment pairs (HSPs) detected in these searches aligned the highly conserved region of the RDRPs between the predicted strands 18 and 20, including the DbDGD motif, with the portion of the DDRP β' subunit sequence, which contains the metal-chelating active site, with a similar conserved motif, DxDGD.
Closely spaced acidic residues that coordinate divalent cations are characteristic of the active sites of most nucleic acid polymerases, in spite of the fact that they belong to several unrelated structural folds [ 9 13 14 17 28 29 59 ] . Given that the DbDGD motif is the only set of closely spaced acidic residues shared by the RDRPs and the YRHs, it is likely to form part of the nucleotidyltransferase active site of these enzymes.
The Jade Buddha Temple (Yufosi), in northwest Shanghai, is not old, but it is Shanghai’s leading Buddhist site and quite active with resident monks.