Words similar to active
- actgtg
- actgtggctactcagctgtg-
- acth
- action
- actions
- activated
- activates
- activating
- activation
- activations
- activationâ
- activator
- activators
- activats
- active
- active-control
- active-controlled
- active-duty
- active-site
- actively
- activeperl
- actives
- activestate
- activex
- activities
- activity
- activity-based
- actr
- actttggatcattctatgcag
Example sentences for: active
How can you use “active” in a sentence? Here are some example sentences to help you improve your vocabulary:
These results indicate that IfkA is normally active from about 1 hour to about 7 hours after starvation and normally phosphorylates eIF2α during this time period (however, we have no direct data that demonstrates IfkA phosphorylates eIF2α).
Thus, Rec12 protein and its active site tyrosine are likely required for most crossover recombination throughout the genome.
These data suggest that the Syk-dependent step in signal transduction requires biochemical changes in addition to enzymatic activation, perhaps proper localization of the active enzyme to a signaling receptor complex.
The findings presented here, suggesting that different ECM signaling pathways are active in different cancers, could have important clinical implications, as knowledge of the specific pathways dysregulated in a particular cancer may be valuable for devising effective therapy that targets those pathways.
until William Harvey studied medicine in Padua (1600–1602, while Galileo was active there), it was believed that there were two kinds of blood, arterial blood and venous blood.
Loading...