Words similar to active
- actgtg
- actgtggctactcagctgtg-
- acth
- action
- actions
- activated
- activates
- activating
- activation
- activations
- activationâ
- activator
- activators
- activats
- active
- active-control
- active-controlled
- active-duty
- active-site
- actively
- activeperl
- actives
- activestate
- activex
- activities
- activity
- activity-based
- actr
- actttggatcattctatgcag
Example sentences for: active
How can you use “active” in a sentence? Here are some example sentences to help you improve your vocabulary:
Specifically, our data suggest that the agonist binds and stabilizes (or induces) an active signaling state of Smo while the antagonists bind and stabilize (or induce) an inactive form.
In fluent speakers, the left language-dominant brain hemisphere is most active during speech and language tasks.
Expression of constitutively active 4EBP-1 should lead to a global decrease in cap-dependent translation which could lead to cell cycle arrest.
The relative potencies of the most active derivatives - 1.2, 1.3, 1.4 and 1.5 - are shown in Figure 1d.
To demonstrate that the DHBV P protein possesses an RNAseH activity that is active on RNA:DNA heteroduplexes generated during reverse transcription, we altered P amino acid 715 from aspartic acid to valine (D715V) within the RNAseH domain of P and examined the effect of this mutation on reverse transcription in viral core particles.
Loading...