Words similar to activities
- actgtggctactcagctgtg-
- acth
- action
- actions
- active
- actives
- activestate
- activewear
- activism
- activist
- activists
- activists--
- activites
- activities
- activities-
- activities--a
- activities--performing
- activities--we
- activities-terrorist
- activities—individual
- activity
- activity-based
- activity-dependent
- activization
- actof
- actr
- actttggatcattctatgcag
- actual
Example sentences for: activities
How can you use “activities” in a sentence? Here are some example sentences to help you improve your vocabulary:
The checkpoint system in fission yeast also allows cells to recover from checkpoint-induced cell cycle arrest [ 9 39 40 ] . Together with the other Checkpoint Rad proteins, the Rad26/Rad3 complex controls this genetically defined pathway that likely regulates DNA repair activities.
Intelligence report, Bin Ladin's Activities in Eritrea, Mar.
The Joint Committee recommended that the MSBA consider reporting of pro bono activities.
Executive Director David Carey told us they saw the projects as a "distraction" that would pull personnel and resources away from other, high-priority activities, such as worldwide disruptions.
You’ll find the most diverse range of beach activities at Mátala, Agía Galíni, and Plakiás.
Loading...