Words similar to activities
- actgtggctactcagctgtg-
- acth
- action
- actions
- active
- actives
- activestate
- activewear
- activism
- activist
- activists
- activists--
- activites
- activities
- activities-
- activities--a
- activities--performing
- activities--we
- activities-terrorist
- activities—individual
- activity
- activity-based
- activity-dependent
- activization
- actof
- actr
- actttggatcattctatgcag
- actual
Example sentences for: activities
How can you use “activities” in a sentence? Here are some example sentences to help you improve your vocabulary:
These two consensus sequences are therefore good candidates for playing important roles in the enhancer activities mediated by regions 20 and 21.
conducts investigations to assess whether illegal or improper activities are occurring; and
Examples are the bifunctional proteins ThrA (aspartokinase I and homoserine dehydrogenase I) and MetL (aspartokinase II and homoserine dehydrogenase II) where only the amino-terminal modules representing the kinase activities have been identified on the basis of their sequence similarity to the E. coli unimodular aspartokinase III (LysC).
For the Secretary's activities, see DOD memo, interview of Donald Rumsfeld, Dec. 23, 2002; Stephen Cambone interview (July 8, 2004).
Under this arrangement, JI would perform the necessary casing activities and locate bomb-making materials and other supplies.
Loading...