Words similar to activities
- actgtggctactcagctgtg-
- acth
- action
- actions
- active
- actives
- activestate
- activewear
- activism
- activist
- activists
- activists--
- activites
- activities
- activities-
- activities--a
- activities--performing
- activities--we
- activities-terrorist
- activities—individual
- activity
- activity-based
- activity-dependent
- activization
- actof
- actr
- actttggatcattctatgcag
- actual
Example sentences for: activities
How can you use “activities” in a sentence? Here are some example sentences to help you improve your vocabulary:
It does not appear that any government other than the Taliban financially supported al Qaeda before 9/11, although some governments may have contained al Qaeda sympathizers who turned a blind eye to al Qaeda's fundraising activities.
Malaysia's prime minister responded in Kuala Lumpur's Star, saying the announcement was misleading, as it would displace attention from other countries where the threat is very real, whereas "there are no terrorist activities" in Malaysia.
These activities may be grouped under the following phases of an implementation project: (1) conducting an engineering review of the facility and awarding a procurement contract; (2) obtaining a construction permit; (3) installing the control technology; and (4) obtaining an operating permit.
Outdoor Activities
The gene product of PTEN ( phosphatase and tensin homolog deleted from chromosome 10) is a lipid phosphatase that reverses the activities of phosphatidylinositol 3-kinase (PI3K) by dephosphorylating the D3 position of its lipid products, phosphatidylinositol-3, 4 bis-phosphate (PtdIns(3,4)P2), phosphatidylinositol-3,5 bis-phosphate (PtdIns(3,5)P2), and 3,4,5-tri-phosphate (PtdIns(3,4,5)P3) [ 2, 3], the elevated levels of which are linked to the transforming ability of PI3K [reviewed in ref.
Loading...