Words similar to activities
- actgtggctactcagctgtg-
- acth
- action
- actions
- active
- actives
- activestate
- activewear
- activism
- activist
- activists
- activists--
- activites
- activities
- activities-
- activities--a
- activities--performing
- activities--we
- activities-terrorist
- activities—individual
- activity
- activity-based
- activity-dependent
- activization
- actof
- actr
- actttggatcattctatgcag
- actual
Example sentences for: activities
How can you use “activities” in a sentence? Here are some example sentences to help you improve your vocabulary:
Since luciferase molecular specific activity may vary depending on the amino acid sequence of the protein, control vectors in which the UAG stop codon has been replaced by a CAG glutamine codon were similarly transfected and their activities standardized for transfection efficiency.
And you are correct that you cannot dictate private activities in someone else's home, unless body parts are sailing by your window.
The collection brings the ancient Greek world to life shedding light on almost every aspect of the daily activities of the citizens.
It might seem that research activities apply only to the knowledge base aspect of the model.
These activities have helped develop a sense of community that enabled everyone to endure and succeed, even in difficult times.
Loading...