Words similar to activities
- actgtggctactcagctgtg-
- acth
- action
- actions
- active
- actives
- activestate
- activewear
- activism
- activist
- activists
- activists--
- activites
- activities
- activities-
- activities--a
- activities--performing
- activities--we
- activities-terrorist
- activities—individual
- activity
- activity-based
- activity-dependent
- activization
- actof
- actr
- actttggatcattctatgcag
- actual
Example sentences for: activities
How can you use “activities” in a sentence? Here are some example sentences to help you improve your vocabulary:
For information about lessons and/or guided group excursions involving some of the activities listed below (climbing, walking, mountain biking, canoeing, and sailing), contact one of the following organizations: Summitreks, 14 Yewdale Road, Coniston, Cumbria LA21 8DU; Tel. (015394) 41212, fax (015394) 41055, or Total Adventure, Holehird Farm, Patterdale Road, Windermere LA23 1NP; Tel. (015394) 47302.
Examples of Control Activities
In contrast to their shared structure, the AAA proteins participate in diverse cellular activities, including proteolysis, protein folding and unfolding, membrane trafficking, DNA replication, metal ion metabolism and intracellular motility [ 13 14 15 ] . Recent structural studies have revealed that the protomers of an AAA protein usually oligomerize into ring-shaped hexameric structures that constitute molecular platforms essential to their mode of action.
The activities would, however, be primarily logistic rather than active fighting.
It grieves Tasmanians that the Island State [or Flyspeck or Speck ] is sometimes left off the map of Australia, yet no one visiting the former convict colony can be untouched by the tangible pervasiveness of the past and the importance attached by Tasmanians to activities and events which, in mainland terms, are long gone.