Words similar to activities
- actgtggctactcagctgtg-
- acth
- action
- actions
- active
- actives
- activestate
- activewear
- activism
- activist
- activists
- activists--
- activites
- activities
- activities-
- activities--a
- activities--performing
- activities--we
- activities-terrorist
- activities—individual
- activity
- activity-based
- activity-dependent
- activization
- actof
- actr
- actttggatcattctatgcag
- actual
Example sentences for: activities
How can you use “activities” in a sentence? Here are some example sentences to help you improve your vocabulary:
Your contributions help fund athlete scholarships ($5,000 = one student per year), awards, special events, program advertising and membership activities.
At the conference, they defended their activities against numerous critics: Solidarity leaders denied they made too many compromises; priests denied they had been co-opted by the party; and Communists denied they had committed treason.
These activities may be grouped under the following phases of an implementation project: (1) conducting an engineering review of the facility and awarding a procurement contract; (2) obtaining a construction permit; (3) installing the control technology; and (4) obtaining an operating permit.
Double-strand (ds) breakage of chromosomal DNA is obviously a serious threat to cells because various activities of the chromosome - gene expression, replication and partition - depend on its integrity.
They are not earned by the entity's activities, demanded by the entity, or donated to the entity.
Loading...