Words similar to activities
- actgtggctactcagctgtg-
- acth
- action
- actions
- active
- actives
- activestate
- activewear
- activism
- activist
- activists
- activists--
- activites
- activities
- activities-
- activities--a
- activities--performing
- activities--we
- activities-terrorist
- activities—individual
- activity
- activity-based
- activity-dependent
- activization
- actof
- actr
- actttggatcattctatgcag
- actual
Example sentences for: activities
How can you use “activities” in a sentence? Here are some example sentences to help you improve your vocabulary:
Although the activities of city and rural carriers are similar, some minor differences exist:
Some of these activities include nucleic acid binding [ 11 ] , ribonuclease activity (for processing preribosomal RNA) [ 12 ] and association with maturing preribosomal ribonucleoprotein particles [ 13 14 ] . It may also be involved in the transport of ribosomal or other nucleosomal proteins across the nuclear membrane, as it is known to shuttle between the cytoplasm and nucleus and to stimulate the nuclear importation of proteins [ 15 16 ] . Nucleophosmin also appears to be intimately involved in centrosome duplication.
(Since then, Granma 's front page has led, for three days in a row, with the activities in Havana of the visiting prime minister of St. Kitts, Denzil Douglas.)
Press accounts invariably suggested that Sara Lee's divestment of manufacturing operations would free cash "currently tied up in low-margin activities."
Several research groups have published data in support of DJ-1 having one or more of these activities, including the report, published in this issue of PLoS Biology , that DJ-1 is a molecular chaperone that regulates α-synuclein, among other molecules (Shendelman et al.
Loading...