Words similar to activity
- acth
- action
- actions
- active
- activewear
- activist
- activists
- activities
- activities-
- activities--a
- activities--performing
- activities--we
- activities-terrorist
- activities—individual
- activity
- activity-
- activity--is
- activity--primarily
- activity--repealed
- activity--safer
- activity-based
- activity-dependent
- activization
- actof
- actograms
- acton
- actr
- actttggatcattctatgcag
- actual
- actually
Example sentences for: activity
How can you use “activity” in a sentence? Here are some example sentences to help you improve your vocabulary:
The analysis of drug activity was performed using PRISM software (GraphPad Software, Inc.
A quantitation of the distribution and flux of each factor is essential for developing a physical model for a cellular activity.
Excess GC activity due to LIFR loss is an unexpected result since LIF gain-of-function mice develop a Cushing's-like syndrome [ 29 30 ] . Thus, if the relationship were simple, loss of LIFR function would predict development of GC insufficiency.
In reverse genetics, researchers start with a gene of interest and investigate the phenotypic effect of altering its activity; by contrast, in ‘forward genetics’ the starting point is to look for a particular phenotype and then hunt out the altered gene that is causing it.
Alkaline phosphatase activity of circulating BMPCs
Loading...