Words similar to activity
- acth
- action
- actions
- active
- activewear
- activist
- activists
- activities
- activities-
- activities--a
- activities--performing
- activities--we
- activities-terrorist
- activities—individual
- activity
- activity-
- activity--is
- activity--primarily
- activity--repealed
- activity--safer
- activity-based
- activity-dependent
- activization
- actof
- actograms
- acton
- actr
- actttggatcattctatgcag
- actual
- actually
Example sentences for: activity
How can you use “activity” in a sentence? Here are some example sentences to help you improve your vocabulary:
Cytosolic extracts of HL-60 cells were analyzed for ALDH activity using a Perkin Elmer 650 spectrofluorometer with an excitation wavelength of 350 nM and an emission wavelength of 460 nM.
Transmission in the HIV +donors was approximately 60% from intravenous drug use and 40% from unprotected sexual activity.
The I-TRAP method might also be used to characterize promoter activity in two environmental conditions in a manner similar to the IVET approach [ 16 ] . This is useful because, in some cases, the factor necessary for transcriptional activation during a particular environmental condition is unknown.
The think tank's panel agreed, recommending that political activity on the Internet be promoted, "absent specific intent to use the Internet to circumvent the law."
Both moe BR and moe Z coexist in the M. tuberculosis genome, which exhibits nitrate reductase activity, but moe BR is missing from M. leprae , which has no nitrate reductase activity.
Loading...