Words similar to activity
- acth
- action
- actions
- active
- activewear
- activist
- activists
- activities
- activities-
- activities--a
- activities--performing
- activities--we
- activities-terrorist
- activities—individual
- activity
- activity-
- activity--is
- activity--primarily
- activity--repealed
- activity--safer
- activity-based
- activity-dependent
- activization
- actof
- actograms
- acton
- actr
- actttggatcattctatgcag
- actual
- actually
Example sentences for: activity
How can you use “activity” in a sentence? Here are some example sentences to help you improve your vocabulary:
A characteristic phenotype of tumorigenic cells is their ability to grow anchorage-independently in suspension culture, or embedded in soft agar, without the need for attachment to the surface of a cell culture dish [ 25 26 ] . A flurry of papers has established a close link between anchorage-independent growth and the activity of several components of the cell cycle machinery, such as various cyclins, cyclin-dependent kinases (CDKs), and the CDK inhibitors p21 Cip1and p27 Kip1 [ 27 28 29 30 31 32 ] . There are indications that PTEN may be involved in these processes as well.
Tonic patterns of activity, in contrast, would not only promote the mobilization of extracellular calcium but also increase the number of store-operated calcium channels with each bout of exercise.
0020036) on targeted modulation of p53 activity.
Morphogenic activity of the agonist
Stat3 also contains in its N-terminus one of this motifs ( 221LAGLL 225) [ 39 ] . Moreover, Stat3 also presents a Ser at -2 position of the LXXLL sequence, which in the case of the coactivator TRBP defines selectivity for nuclear receptors [ 40 ] . Phosphorylation of Stat3 has been reported to occur only in 705Tyr and in 727Ser, allowing dimerization and full transactivating activity [ 41 ] . Whether this 219Ser next to the LXXLL motif is involved in the coactivator activity of Stat3, and the interaction of Stat3 with other coactivators only takes place in the context of Stat3 transcription factor activity or also can be part of the general mechanism of the transcription complex formation requires further studies.
Loading...