Words similar to activity
- acth
- action
- actions
- active
- activewear
- activist
- activists
- activities
- activities-
- activities--a
- activities--performing
- activities--we
- activities-terrorist
- activities—individual
- activity
- activity-
- activity--is
- activity--primarily
- activity--repealed
- activity--safer
- activity-based
- activity-dependent
- activization
- actof
- actograms
- acton
- actr
- actttggatcattctatgcag
- actual
- actually
Example sentences for: activity
How can you use “activity” in a sentence? Here are some example sentences to help you improve your vocabulary:
To evaluate readthrough efficiency, the luciferase activity obtained from a test construct was compared to the activity of the wild type pRSVL vector, which was used as an internal control of each individual transfection experiment.
The Rangers have evolved over the years and have had periods of low activity and other periods of important law enforcement work.
HD domains typically possess phosphoesterase activity, and are fused to catalytic domains that possess nucleotide kinase, nucleotidyltransferase, nucleotide cyclase or diguanylate cyclase activity [ 19 29 ] . This fits well with the observed cyclase activity seen in CyaB, but is also consistent with phosphotransferase or nucleotidyl transferase for the CYTH domain.
If the correlation coefficients fall and rise in a periodic fashion, resembling a sinusoidal curve, the record of LUC activity is "rhythmic."
In the preactivated oocyte, the nuclear membrane of the donor cells remains intact due to the low activity of MPF and DNA synthesis occurs according to the original cell cycle stage at the time of nuclear transfer [ 12] and nuclear reprogramming occurs during the expansion of the donor nucleus [ 18, 19].
Loading...