Words similar to activity
- acth
- action
- actions
- active
- activewear
- activist
- activists
- activities
- activities-
- activities--a
- activities--performing
- activities--we
- activities-terrorist
- activities—individual
- activity
- activity-
- activity--is
- activity--primarily
- activity--repealed
- activity--safer
- activity-based
- activity-dependent
- activization
- actof
- actograms
- acton
- actr
- actttggatcattctatgcag
- actual
- actually
Example sentences for: activity
How can you use “activity” in a sentence? Here are some example sentences to help you improve your vocabulary:
Quantification of the apparent dissociation constant (K d[app] ) for rDEK binding to related class II MHC Y-box motifs validates the relative hierarchy of DEK binding activity described above, and further emphasizes the contribution of gene-specific Y-box polymorphisms to DEK binding activity.
OUTPUT MEASURE - A tabulation, calculation, or recording of activity or effort that can be expressed in a quantitative or qualitative manner.
tim-luc activity in cultured wings vs. heads to ask whether the luciferase reporter activity peaked at the same time in these two tissues.
It is noticeable that the activity at the onset of the experiment (0 hours, cells attached to tissue culture plates) was higher than background, which likely indicates some basal activity of PTEN in attached cells.
In contrast, DHPS activity (albeit relatively low) was shown in vitro for the partially purified MJ0301 protein [ 25].
Loading...