Words similar to activity
- acth
- action
- actions
- active
- activewear
- activist
- activists
- activities
- activities-
- activities--a
- activities--performing
- activities--we
- activities-terrorist
- activities—individual
- activity
- activity-
- activity--is
- activity--primarily
- activity--repealed
- activity--safer
- activity-based
- activity-dependent
- activization
- actof
- actograms
- acton
- actr
- actttggatcattctatgcag
- actual
- actually
Example sentences for: activity
How can you use “activity” in a sentence? Here are some example sentences to help you improve your vocabulary:
This is the predicted phenotype for an RNAseH-deficient hepadnaviral P protein, and it indicates that the P protein has an RNAseH activity that acts on endogenously synthesized RNA:DNA heteroduplexes.
They have evolved to survive varying internal and external environments by carefully controlling the abundance and activity of these proteins to suit their conditions.
In contrast, in RSV infected cells both DEX and NAC inhibited Rel A and p50 binding activity.
If Pgm Scontributes to the increased lifespan of the O lines, this might be due to increased enzyme activity, decreased enzyme activity, or alteration in enzyme activity in some other way such as in its regulation or subcellular localization.
Seventeen ALDH genes have been identified in the human genome and have been classified into ten different families based on amino acid sequence identities [ 1 2 ] . High levels of ALDH1A1 activity can protect human and murine cells from the toxicity of the alkylating agent cyclophosphamide and its oxazaphosphorine analogs.