Words similar to activity
- acth
- action
- actions
- active
- activewear
- activist
- activists
- activities
- activities-
- activities--a
- activities--performing
- activities--we
- activities-terrorist
- activities—individual
- activity
- activity-
- activity--is
- activity--primarily
- activity--repealed
- activity--safer
- activity-based
- activity-dependent
- activization
- actof
- actograms
- acton
- actr
- actttggatcattctatgcag
- actual
- actually
Example sentences for: activity
How can you use “activity” in a sentence? Here are some example sentences to help you improve your vocabulary:
The amount so collected should be accounted for as a custodial activity by the collecting entity.
To evaluate readthrough efficiency, the luciferase activity obtained from a test construct was compared to the activity of the wild type pRSVL vector, which was used as an internal control of each individual transfection experiment.
Communicating about a personal experience, for example, how a wine tastes, is such an activity.
This Src mutant is inactive against exogenous substrates [ 34 35 36 ] . We also generated fusions of the Cas SD with a Src kinase inactive mutant (K295M) that has no enzymatic activity (Src KM/Cas(SD)), fusions of either the attenuated kinase domain or kinase inactive domain to the 5' or 3' regions of the Cas SD (Src*/Cas(5'SD), Src*/Cas(3'SD), Src KM/Cas(5'SD), Src KM/Cas(3'SD)), as well as the attenuated Src kinase (Src*) alone without the attached Cas SD (Fig.
It has long been known that the sera of patients who suffer from melanoma or mammary carcinoma show higher tyrosinase activity than normal sera [ 35 ] but, to our knowledge, this is the first report of TYRP-1 expression in human breast duct epithelium.
Loading...