Words similar to activity
- acth
- action
- actions
- active
- activewear
- activist
- activists
- activities
- activities-
- activities--a
- activities--performing
- activities--we
- activities-terrorist
- activities—individual
- activity
- activity-
- activity--is
- activity--primarily
- activity--repealed
- activity--safer
- activity-based
- activity-dependent
- activization
- actof
- actograms
- acton
- actr
- actttggatcattctatgcag
- actual
- actually
Example sentences for: activity
How can you use “activity” in a sentence? Here are some example sentences to help you improve your vocabulary:
These same conclusions regarding energy expenditure were reached in experiments assessing enzymatic activities, and transcriptional changes in rat liver using Northern blots, where fish oil feeding: increased palmitoyl CoA mitochondrial and peroxisomal oxidation rate; increased Cpt1, Cpt2, Δ 3, Δ 2-enoyl CoA isomerase, and Ech1 expression and activity; and decreased expression and activity of FA synthase, malic enzyme, glucose 6-phosphate dehydrogenase, and pyruvate kinase, compared to palm and/or safflower oil feeding [ 93 ] . Likewise, in rat white retroperitoneal adipose tissue, fish oil feeding also decreased Fasn expression [ 94 ] . Intriguingly, the hormone leptin, which also acts through SREBP-1 and PPARα, affected many transcripts similarly to LC-PUFA ( e.g. , leptin decreased Gpam and Apoa4 transcripts; and up regulated Ech1, mitochondrial Hmgcs2, and Cyp4a14 transcripts [ 95 ] .
When cells harboring conditional-lethal temperature-sensitive (ts) mutations in any of these proteins are shifted to the restrictive temperature, they uniformly arrest in late anaphase as large-budded cells with segregated chromosomes, fully elongated microtubule spindles, and in all tested cases, elevated Cdc28/Clb2 protein kinase activity (Cdc28 is the major cyclin-dependent kinase Cdk1 and Clb2 the major mitosis-specific cyclin of budding yeast) (reviewed in [ 1 ] , [ 2 ] ).
This assessment of physical activity is reliable, valid and has been performed by other investigators in the past [ 4 5 ] .
Recreational cycling on Montjuïc and Tibidabo is very popular, and of course swimming and sunning—whether at the city beaches or along the Costa Daurada and Costa Brava—is a prime Mediterranean activity.
Its activity is therefore important for both glycolysis and glycogen synthesis, and the altered Pgm allele frequency might therefore be relevant to the increased glycogen and lipid stores of the O strains.
Loading...