Words similar to activity
- acth
- action
- actions
- active
- activewear
- activist
- activists
- activities
- activities-
- activities--a
- activities--performing
- activities--we
- activities-terrorist
- activities—individual
- activity
- activity-
- activity--is
- activity--primarily
- activity--repealed
- activity--safer
- activity-based
- activity-dependent
- activization
- actof
- actograms
- acton
- actr
- actttggatcattctatgcag
- actual
- actually
Example sentences for: activity
How can you use “activity” in a sentence? Here are some example sentences to help you improve your vocabulary:
The investigation of BMD and colorectal cancer risk, therefore, provides a new perspective in the analysis of calcium and colorectal cancer risk, and in addition provides information on two other factors for colorectal cancer that are thought to diminish risk: physical activity and estrogen [ 10 ] . This is the first such report analyzing this association.
Data were plotted as a GS-E(RLU1/RLU2)/Control(RLU1/RLU2) ratio (as in Table 1) fold induction over the 0 drug concentration which was set empirically as 1. These results show an increase in gene inducing activity with increasing GS-E concentrations up to 10 μM.
Tissue was washed and treated with 0.5% hydrogen peroxide to remove endogenous peroxidase activity.
The degradative activity toward TNT was dependent on the addition of water.
Therefore, despite constitutive Syk kinase activity, the ITAMs in the dominant-positive-expressing cells remain hypophosphorylated because kinases that are upstream of Syk and/or are Syk independent are not active in the absence of BCR crosslinking.
Loading...