Words similar to activity
- acth
- action
- actions
- active
- activewear
- activist
- activists
- activities
- activities-
- activities--a
- activities--performing
- activities--we
- activities-terrorist
- activities—individual
- activity
- activity-
- activity--is
- activity--primarily
- activity--repealed
- activity--safer
- activity-based
- activity-dependent
- activization
- actof
- actograms
- acton
- actr
- actttggatcattctatgcag
- actual
- actually
Example sentences for: activity
How can you use “activity” in a sentence? Here are some example sentences to help you improve your vocabulary:
For example, follistatin binds both activin and BMP-7 avidly but competes weakly or not at all with the type I receptor for BMP-4 binding [ 25 45 ] , whereas noggin binds to BMPs -2 and -4 with greater affinity than BMP-7 [ 46 ] . Whether BMP-5 function can be antagonized by noggin or follistatin has not been previously reported, but our results suggest that simultaneous addition of either antagonist with BMP-5 significantly inhibits the dendrite-promoting activity of BMP-5 in a concentration-dependent manner.
[ 32 33 ] identified peptides binding to the erythropoietin (EPO) receptor with full agonist activity in vivo . Neither the EPO agonist nor the IL-1 antagonist peptides show any significant sequence homology to the natural ligand suggesting that they act as mimics of the natural ligand.
6panel F, the effect of PMA on K ATP activity, which produces hyperpolarization, varied as a function of intracellular ATP concentration.
Finally, our data suggest that the L91 target locus acquires limited trans-silencing activity of its own after exposure to C73, which is an unusual case for transgenes.
Colony filter-lift assays to detect β-galactosidase activity were performed as described by Clontech laboratories.