Words similar to pct

Example sentences for: pct

How can you use “pct” in a sentence? Here are some example sentences to help you improve your vocabulary:

In order to assess the diagnostic utility of PCT and CRP in a medical ICU, prospective measurements were conducted in 101 consecutive patients with acute SIRS or sepsis.
2 kb upstream of the translation start codon of pct1 +or pce1 +; L2, a 40-mer in which 20 bases were identical to the 5' sequence of pFA6a-KanMX4 (GCTTCAGCTGGCGGCCGCGT) and 20 bases were identical to the antisense strand sequence immediately 5' of the translation start site of pct1 +or pce1 +; L3, a 40-mer in which 20 bases were identical to the 3' sequence of pFA6a-KanMX4 (AGTGGCCTATGCGGCCGCGG) and 20 bases corresponded to the sense-strand sequence immediately 3' of the stop codon of
Therefore, we selected several cytokines as well as PCT for early diagnosis (and differentiation) of patients with SIRS and sepsis.
We used a modified version of the long flanking homology PCR technique [ 17 ] to produce pct1Δ and pce1Δ gene disruption cassettes in which the open reading frames were replaced by the kanMX gene.
IL-2, IL-8 and PCT levels were different between groups.