Words similar to pcr

Example sentences for: pcr

How can you use “pcr” in a sentence? Here are some example sentences to help you improve your vocabulary:

Labeled product can be generated by incorporating fluorescent (or otherwise modified) nucleotides during PCR.
PCR products were generated using the following primer set: sense primer (5'TGACATCTGAGCTCTATGAGGGT3', GenBank AF365927 nucleotides 545-567) and antisense primer 5'CCCAGGGAGTCCTGGGCCCGGA3' (nucleotides 782-803).
As expected, the ribozyme sequence-specific primers produced a 430-bp PCR fragment only in cells infected with Ad-GFP/Rz-IGF2R, but not in cell infected with the control viral vector Ad-GFP.
PCR reactions were cycled 35 times under the following conditions: 94 degrees for 30 seconds, 55 degrees for 1 minute and 72 degrees for 2 minutes.
Real-time PCR was used to test the accuracy of our microarray results (Figure 5a).