Words similar to pdl

Example sentences for: pdl

How can you use “pdl” in a sentence? Here are some example sentences to help you improve your vocabulary:

It is difficult to estimate the number of genes that were tested in the PdL screen, but it is certain to have been only a tiny fraction of the genome.
Line PdL(3)2C33 contains an insert at the 5' end of a gene with homology to a maltose permease from Bacillus stearothermophilus [ 37], which was named Sugar baby (Figure 3c).
Line PdL(3)8S25 contained an insert at the 5' end of the 'B' transcript of the four wheel drive ( fwd ) gene (Figure 3e).
DNA was transferred to a Southern blot and hybridized with a radiolabeled 172 bp fragment from the 3' P end of PdL . This probe fragment was generated by PCR amplification with primers located within the 3' P end, IRREV (ATGATGAAATAACATAAGGTGGTCCCG) and P3MCSREV (ATGAGTTAATTCAAACCCCACGGACAT).
In addition, lines in which PdL causes overexpression of a gene with large negative effects on life span should have been eliminated by this step.