Example sentences for: amplified

How can you use “amplified” in a sentence? Here are some example sentences to help you improve your vocabulary:

  • In both cases, we found no evidence for sequence alterations, when we amplified the deleted and flanking exons and their splice sites individually from genomic DNA (data not shown).

  • Dylan, though shaken by the fury of his fans, pressed ahead, trading his work shirt and jeans for a velveteen Nehru jacket and playing amplified rock 'n' roll.

  • Complementary DNA fragments for SKP2, p27, and GAPDH were amplified by PCR and radiolabeled by random priming.

  • Thus, from the amplified results, one cannot infer the relative expression levels of different genes in a single sample.

  • G3PDH gene fragment of approximately 300 bp was amplified with G3PDH 3' and 5' primers (GAPA-F: GGTAGGATCGGGAGGAAC; GAPA-R: GATAACCTTCTTGGCACCAG) using the adaptor-ligated cDNA as template.


How many words do you know? Try our free vocabulary size test!


Search

Search for example sentences

Loading Loading...
Quantcast