Words similar to amplified

Example sentences for: amplified

How can you use “amplified” in a sentence? Here are some example sentences to help you improve your vocabulary:

The F1-R1 and F2-R1 primer pair products (F1-R1a and F2-R1a) amplified from a T +/+ embryo represented the expected wild type T RNA species (6,7,8 and 4,5,6,7,8; Figure 1B, Table 2, and Figure 3B.)
Ninety-five months after diagnosis (operation), the estimated DFS of c- myc -amplified cancer patients was only 85.
Transcript 2 was amplified using primers T-21 and T-22.
G3PDH gene fragment of approximately 300 bp was amplified with G3PDH 3' and 5' primers (GAPA-F: GGTAGGATCGGGAGGAAC; GAPA-R: GATAACCTTCTTGGCACCAG) using the adaptor-ligated cDNA as template.
Primer pairs specific for each TMC transcript amplified products of predicted length and sequence (Figure 5).