Words similar to amplified
Example sentences for: amplified
How can you use “amplified” in a sentence? Here are some example sentences to help you improve your vocabulary:
In both cases, we found no evidence for sequence alterations, when we amplified the deleted and flanking exons and their splice sites individually from genomic DNA (data not shown).
Dylan, though shaken by the fury of his fans, pressed ahead, trading his work shirt and jeans for a velveteen Nehru jacket and playing amplified rock 'n' roll.
Complementary DNA fragments for SKP2, p27, and GAPDH were amplified by PCR and radiolabeled by random priming.
Thus, from the amplified results, one cannot infer the relative expression levels of different genes in a single sample.
G3PDH gene fragment of approximately 300 bp was amplified with G3PDH 3' and 5' primers (GAPA-F: GGTAGGATCGGGAGGAAC; GAPA-R: GATAACCTTCTTGGCACCAG) using the adaptor-ligated cDNA as template.