Words similar to amplify
Example sentences for: amplify
How can you use “amplify” in a sentence? Here are some example sentences to help you improve your vocabulary:
The 5' and 3' primers contained Nde I and Bam HI restriction sites, respectively, and were designed to amplify the rec12 +cDNA from the first ATG in exon 1 to a position +142 bp downstream of the stop codon in exon 5. RT-PCR products were cloned by blunt-end ligation into pCR-Blunt (Invitrogen Corp.) and both strands were subject to DNA sequencing (GenBank accession no.
prad26reverse : GATGTGGGTGCGGGACGGGAAAGAACAACACTGAAGAAACAAGTATCATTATTTCATTTGAAAAATTAGGGAAATGAATTCGAGCTCGTTTAAAC) were used to amplify the GFP (S65T)-kanMX6 module of pFA6a-GFP (S65T)-kanMX6 [ 41 ] in ten separate 50 μl PCR reactions using Accuzyme, high-fidelity polymerase (Bioline, Randolph, MA).
After sequencing the M. tuberculosis H37Rv insert in the recovered plasmid, PCR primers were designed to amplify a product containing a portion of the cloned M. tuberculosis H37Rv genomic DNA.
Primer pairs were designed (Table 1) that would only amplify one of the four transcripts.
CCL2, CCL3, CCL5 and CXCL8 occur in human RA synovial fluid and tissue [ 8 ] . Therefore the ligands for the binding sites described here occur endogenously within the RA joint, adding further evidence towards a role for these receptors in vivo . In the RA joint the synovial macrophage is among the principle cell types that produce CCL2, CCL3 and CXCL8 [ 8 17 ] . The finding of chemokine receptors on these cells suggests that macrophages may amplify inflammation by attracting cells of the same type, and other cell types, into the joint thereby setting up a positive feedback loop.
Loading...