Words similar to amplify
Example sentences for: amplify
How can you use “amplify” in a sentence? Here are some example sentences to help you improve your vocabulary:
prad26reverse : GATGTGGGTGCGGGACGGGAAAGAACAACACTGAAGAAACAAGTATCATTATTTCATTTGAAAAATTAGGGAAATGAATTCGAGCTCGTTTAAAC) were used to amplify the GFP (S65T)-kanMX6 module of pFA6a-GFP (S65T)-kanMX6 [ 41 ] in ten separate 50 μl PCR reactions using Accuzyme, high-fidelity polymerase (Bioline, Randolph, MA).
A total of 35 cycles (94°C/20 sec; 56°C/20 sec; 72°C/1 min) was used to amplify both exons 2 and 3. PCR amplification products were purified using the QIAquick PCR Purification Kit (Qiagen) and both strands were sequenced on an ABI automated sequencer.
This current set consists of primers to amplify the dp427m promoter including exon 1 and exons 3, 4, 6, 8, 12, 13, 17, 19, 43, 44, 45, 47, 48, 49, 50, 51, 52, 60.
It could be speculated that apoptotic alterations of the Golgi complex may facilitate the transportation of death receptors from the Golgi complex to the plasma membrane, and may amplify the apoptotic events once apoptosis was initiated.
Based upon the structure of mouse genes, putative rat-specific exonic primers were designed and used to amplify rat genomic regions as previously described.