Example sentences for: amplification

How can you use “amplification” in a sentence? Here are some example sentences to help you improve your vocabulary:

  • Other examples of specimen requiring amplification for genome-wide characterization of gene expression include purified populations of cells obtained by either flow cytometry, laser capture microdissection, breast ductal or bronchial lavage, or microendoscopy.

  • A smaller DNA fragment representing the 5' end of the dmsA promoter region from position -127 to -13 relative to the start of transcription was also constructed by PCR amplification using pPC25 as template and oligonucleotides oSB15 and oSB21 (5'GTAGTATTACTAGTAAGTGAGG'3).

  • DNA was transferred to a Southern blot and hybridized with a radiolabeled 172 bp fragment from the 3' P end of PdL . This probe fragment was generated by PCR amplification with primers located within the 3' P end, IRREV (ATGATGAAATAACATAAGGTGGTCCCG) and P3MCSREV (ATGAGTTAATTCAAACCCCACGGACAT).

  • For each cDNA sample under investigation triplicate reaction wells were set up for both GAPDH and target amplification.

  • In another study, PCR amplification products (previously sequence-verified cDNA clones) were re-sequenced and only 79% of the clones matched the original database [ 12 ] . In a different study, it was estimated that only 80% of the genes in a set of microarray experiments were correctly identified [ 5 ] . Therefore, we advise that when preparing cDNA microarrays (commercial or homemade), it is necessary to sequence verify each clone at the final stage before printing the microarray.


How many words do you know? Try our free vocabulary size test!


Search

Search for example sentences

Loading Loading...
Quantcast