Words similar to amplification

Example sentences for: amplification

How can you use “amplification” in a sentence? Here are some example sentences to help you improve your vocabulary:

Primers and amplification conditions for IDO amplification have been described elsewhere [ 17].
Amplification of the 110 bp fragment of this cDNA would indicate contamination of the epididymal cells with sperm.
The DNA probe for exon 5 of the fwd gene was generated by PCR amplification from Drosophila genomic DNA using primers FWDFWD (TGCTTCCTCCATTTGGCGAAC) and FWDREV (ATCATCTGTGGCTCAGAGTCG).
We conclude that the amplifications were reproducible and that good proportionality of RNA was maintained during amplification even if the concentration of poly(A) +RNA differed by tenfold.
The effect of amplification can be summarized by saying that it has a dampening effect on the true expression of some genes (decreased variance in gene expression - see Figure 4).