Words similar to access
- acccccatctcactaattcc-
- accctctccaaaatcccataa
- acceptability
- acceptable
- acceptance
- accepted
- accepting
- acceptor
- acceptors
- acceptor—so
- accepts
- access
- access--and
- access--but
- access--happen
- access--including
- access--makes
- accessed
- accessibility
- accessible
- accessing
- accession
- accgtgaaaagatgatgacccag
- accgtgaccg
- accidental
- accommodations
- accomplishments
Example sentences for: access
How can you use “access” in a sentence? Here are some example sentences to help you improve your vocabulary:
Access to the courts has been enhanced through a variety of self-help options, including online assistance in every county, a system of family law facilitators, increased funding for alternative dispute resolution and simplified forms and procedures.
After data from the desired region have been loaded, a navigation bar allows the user to easily access other regions of the genome - for example, the region immediately upstream or downstream of the currently displayed sequence.
Security: the ability to prevent unauthorized access and tampering and consideration of national security and emergency preparations.
Our objective function and model can be used to calculate allocation strategies that provide equity in access (compensating for geographical isolation), but if authorities in a given nation prioritize a different goal for ARV rollout, then an objective function to optimize can be formulated to reflect the specific national policy goal.
The main courtyard allows access to the adjoining church of St-Louis-des-Invalides, decorated with flags taken by French armies in battle.
Loading...