Words similar to access
- acccccatctcactaattcc-
- accctctccaaaatcccataa
- acceptability
- acceptable
- acceptance
- accepted
- accepting
- acceptor
- acceptors
- acceptor—so
- accepts
- access
- access--and
- access--but
- access--happen
- access--including
- access--makes
- accessed
- accessibility
- accessible
- accessing
- accession
- accgtgaaaagatgatgacccag
- accgtgaccg
- accidental
- accommodations
- accomplishments
Example sentences for: access
How can you use “access” in a sentence? Here are some example sentences to help you improve your vocabulary:
That is why today the Trust is a leading advocate for enabling free access to research literature through support for new publishing models, such as that of the Public Library of Science, and the establishment of publicly accessible repositories, working in partnership with the United States National Institutes of Health–funded PubMed Central [1].
So unlike people who are fortunate enough to be able to afford attorneys and can go to another lawyer, our clients are simply lost in the legal system if they cannot get access to it from us."
As noted in our prior correspondence concerning this matter, the information we are seeking is clearly within our statutory audit and access authority.
When I was a graduate student (in the late 1980s and early 1990s), PubMed was restricted to those institutions that could afford the subscription fee; now PubMed is freely available to all who have Internet access.
We strongly encourage all users to access the Comparative RNA Web Site http://www.rna.icmb.utexas.eduusing its main address, http://www.rna.icmb.utexas.edu/, rather than through specific URLs.