Words similar to acceptable
- acccaagatacctcatcacag-
- acccatgtcaaacccatcag-
- acccccatctcactaattcc-
- accctctccaaaatcccataa
- accent
- accents
- accenture
- accep-tance
- accept
- accept--a
- accept--or
- acceptability
- acceptable
- acceptably
- acceptance
- acceptance--of
- acceptance-speech
- acceptanceprocedures
- accepted
- accepting
- accepts
- access
- accgtgaaaagatgatgacccag
- accgtgaccg
- accidental
Example sentences for: acceptable
How can you use “acceptable” in a sentence? Here are some example sentences to help you improve your vocabulary:
Increase in the number of PCR cycles and/or a longer extension time (5 minutes) were also tested and found to be not acceptable because non-specific output, in the form of multiple gel bands or smearing gel lanes, frequently appeared.
John Paul II is not afraid--of religion's cultured despisers, of geopoliticians who find his near-pacifism naive, of liberal Catholics who accuse him of betraying the spirit of the Second Vatican Council ("Vatican II"), of feminists who suspect that he sees only two acceptable roles for women--virgin and mother.
(1) A written guarantee that a system or componentcomplies with its specified requirements and is acceptable for operational use.
In addition, some users may feel no compunction against browsing sensitive organizational computer files or inappropriate Internet sites if there is no clear guidance on what types of user behavior are acceptable.
But we want to make flawed writing acceptable.
Loading...