Words similar to acceptability
- accattgagctcttcactgatgaacttcacc-
- acccaagatacctcatcacag-
- acccatgtcaaacccatcag-
- acccccatctcactaattcc-
- accctctccaaaatcccataa
- accelrys
- accent
- accents
- accenture
- accent—as
- accep-tance
- accept
- accept--a
- accept--or
- acceptability
- acceptable
- acceptably
- acceptance
- acceptance--of
- acceptance-speech
- accepted
- accepting
- accepts
- access
- accgtgaaaagatgatgacccag
- accgtgaccg
Example sentences for: acceptability
How can you use “acceptability” in a sentence? Here are some example sentences to help you improve your vocabulary:
Flexibility and Acceptability
If routine reference toxicant tests fail to meet test acceptability criteria, then the reference toxicant test must be immediately repeated.
It might have been the case that point mutations along an arm would be neutral as long as the status of base-pairing was maintained; this is possible due to the acceptability of G-U base-pairing in RNA.
Coverage and acceptability
Test data are reviewed to verify that test acceptability criteria (TAC) requirements for a valid test have been met.
Loading...