Words similar to acceptability
- accattgagctcttcactgatgaacttcacc-
- acccaagatacctcatcacag-
- acccatgtcaaacccatcag-
- acccccatctcactaattcc-
- accctctccaaaatcccataa
- accelrys
- accent
- accents
- accenture
- accent—as
- accep-tance
- accept
- accept--a
- accept--or
- acceptability
- acceptable
- acceptably
- acceptance
- acceptance--of
- acceptance-speech
- accepted
- accepting
- accepts
- access
- accgtgaaaagatgatgacccag
- accgtgaccg
Example sentences for: acceptability
How can you use “acceptability” in a sentence? Here are some example sentences to help you improve your vocabulary:
Water used for culturing and test dilution should be analyzed for toxic metals and organics at least annually or whenever difficulty is encountered in meeting minimum acceptability criteria for control survival and reproduction or growth.
But another kind of bestness involves an unobtrusive, day-in day-out acceptability.
If routine reference toxicant tests fail to meet test acceptability criteria, then the reference toxicant test must be immediately repeated.
It might have been the case that point mutations along an arm would be neutral as long as the status of base-pairing was maintained; this is possible due to the acceptability of G-U base-pairing in RNA.
Water used for culturing and test dilution water should be analyzed for toxic metals and organics at least annually or whenever difficulty is encountered in meeting minimum acceptability criteria for control survival and reproduction or growth.
Loading...