Words similar to acceptability
- accattgagctcttcactgatgaacttcacc-
- acccaagatacctcatcacag-
- acccatgtcaaacccatcag-
- acccccatctcactaattcc-
- accctctccaaaatcccataa
- accelrys
- accent
- accents
- accenture
- accent—as
- accep-tance
- accept
- accept--a
- accept--or
- acceptability
- acceptable
- acceptably
- acceptance
- acceptance--of
- acceptance-speech
- accepted
- accepting
- accepts
- access
- accgtgaaaagatgatgacccag
- accgtgaccg
Example sentences for: acceptability
How can you use “acceptability” in a sentence? Here are some example sentences to help you improve your vocabulary:
, those that met test acceptability criteria) that were used in the analysis of precision.
It might have been the case that point mutations along an arm would be neutral as long as the status of base-pairing was maintained; this is possible due to the acceptability of G-U base-pairing in RNA.
, consistently meets test acceptability criteria for control responses); is consistent in quality; and does not contain contaminants that could produce toxicity.
Four replicates and 10 organisms per replicate are required for each treatment (see Summary of Test Conditions and Test Acceptability Criteria in the specific test method).
Job aids acceptability, visibility and use
Loading...