Words similar to accomplishments
- access
- accgtgaaaagatgatgacccag
- accgtgaccg
- accidental
- accommodations
- accompany
- accompanying
- accomplish
- accomplished
- accomplishes
- accomplishing
- accomplishment
- accomplishment--if
- accomplishment--the
- accomplishments
- accord
- accord--
- accord--for
- accordance
- accordancewith
- according
- accordingly
- accordionated
- accords
- account
- accountability
- accountants
- accounting
Example sentences for: accomplishments
How can you use “accomplishments” in a sentence? Here are some example sentences to help you improve your vocabulary:
The school is enjoying full enrollment with many accomplishments being achieved by students and graduates.
By describing how the annual performance information it has reported relates to its strategic goals and mission, an agency can help its customers and stakeholders understand the relationship between the year's accomplishments and the agency's long-range goals and reason for existence.
The report reviews our accomplishments in meeting our mission and sustaining our core values of accountability, integrity, and reliability.
Their accomplishments are genuine and their states are thriving.
A piece describes the manifold accomplishments of National Institutes of Health Director Harold Varmus, who has won bipartisan support for the research center, focused the NIH on nuts-and-bolts research rather than disease-of-the-week fads, and artfully guided the human genome project.
Loading...