Words similar to accomplishments
- access
- accgtgaaaagatgatgacccag
- accgtgaccg
- accidental
- accommodations
- accompany
- accompanying
- accomplish
- accomplished
- accomplishes
- accomplishing
- accomplishment
- accomplishment--if
- accomplishment--the
- accomplishments
- accord
- accord--
- accord--for
- accordance
- accordancewith
- according
- accordingly
- accordionated
- accords
- account
- accountability
- accountants
- accounting
Example sentences for: accomplishments
How can you use “accomplishments” in a sentence? Here are some example sentences to help you improve your vocabulary:
For all his accomplishments, Herod was nevertheless hated by his subjects; he taxed, he tortured, and he ordered the massacre of male Jewish infants in an attempt to do away with the heralded Messiah.
The school is enjoying full enrollment with many accomplishments being achieved by students and graduates.
Like the other doctors I met, he was quick to brag about his high-tech accomplishments.
One of their first and most significant findings was the discovery of the third kingdom of life, the Archaebacteria (later renamed Archaea) [ 2 3 4 ] . Subsequently, the analysis of ribosomal RNA produced the first phylogenetic tree, based on the analysis of a single molecule, that included prokaryotes, protozoa, fungi, plants, and animals [ 4 ] . These accomplishments were the foundation for the subsequent revolution in rRNA-based phylogenetic analysis, which has resulted in the sequencing of more than 10,000 16S and 16S-like rRNA and 1,000 23S and 23S-like rRNA genes, from laboratories trying to resolve the phylogenetic relationships for organisms that occupy different sections of the big phylogenetic tree.
As it enters its third and final year, upon implementation, this three-year plan has led to the following accomplishments:
Loading...