Words similar to accomplishments
- access
- accgtgaaaagatgatgacccag
- accgtgaccg
- accidental
- accommodations
- accompany
- accompanying
- accomplish
- accomplished
- accomplishes
- accomplishing
- accomplishment
- accomplishment--if
- accomplishment--the
- accomplishments
- accord
- accord--
- accord--for
- accordance
- accordancewith
- according
- accordingly
- accordionated
- accords
- account
- accountability
- accountants
- accounting
Example sentences for: accomplishments
How can you use “accomplishments” in a sentence? Here are some example sentences to help you improve your vocabulary:
Included in the 'accomplishments' were being fired from a job, suing someone for discrimination, three near-death experiences, and an extended hospital stay.
When senior managers appreciate business accomplishments, they are willing to spend funds for staff recognition.
A piece describes the manifold accomplishments of National Institutes of Health Director Harold Varmus, who has won bipartisan support for the research center, focused the NIH on nuts-and-bolts research rather than disease-of-the-week fads, and artfully guided the human genome project.
"Among his many other accomplishments, Muhammad Ali invented rap."
Clinton should seek to mitigate it with international accomplishments.
Loading...