Words similar to accomplishments
- access
- accgtgaaaagatgatgacccag
- accgtgaccg
- accidental
- accommodations
- accompany
- accompanying
- accomplish
- accomplished
- accomplishes
- accomplishing
- accomplishment
- accomplishment--if
- accomplishment--the
- accomplishments
- accord
- accord--
- accord--for
- accordance
- accordancewith
- according
- accordingly
- accordionated
- accords
- account
- accountability
- accountants
- accounting
Example sentences for: accomplishments
How can you use “accomplishments” in a sentence? Here are some example sentences to help you improve your vocabulary:
Miyares has received many awards for his business accomplishments.
For all his accomplishments, Mr. Clinton's legacy has been permanently stained."
Mr. Chairman, I am also proud of GAO's accomplishments in supporting the Congress and helping improve the performance and accountability of government for the benefit of the American people.
I think you can be proud, just as I am, of the graduates of your law school and of their accomplishments.
One of their first and most significant findings was the discovery of the third kingdom of life, the Archaebacteria (later renamed Archaea) [ 2 3 4 ] . Subsequently, the analysis of ribosomal RNA produced the first phylogenetic tree, based on the analysis of a single molecule, that included prokaryotes, protozoa, fungi, plants, and animals [ 4 ] . These accomplishments were the foundation for the subsequent revolution in rRNA-based phylogenetic analysis, which has resulted in the sequencing of more than 10,000 16S and 16S-like rRNA and 1,000 23S and 23S-like rRNA genes, from laboratories trying to resolve the phylogenetic relationships for organisms that occupy different sections of the big phylogenetic tree.