Words similar to accounting
- accomplishments
- accordionated
- account
- accountability
- accountancy
- accountant
- accountantand
- accountants
- accountants-
- accountants--no
- accountants-www
- accounted
- accounting
- accounting--it
- accountingrelated
- accounts
- accounts--and
- accounts--even
- accounts-and
- accra
- accreditation
- accrual
- acctcccaaactatagattgggtg
- acctgcactc
- acctran
Example sentences for: accounting
How can you use “accounting” in a sentence? Here are some example sentences to help you improve your vocabulary:
For example, it would require 4,900 pedigrees to have 80% power to detect a locus accounting for 5% of variance in liability to schizophrenia at α = 0.001.
United States General Accounting Office
General Accounting Office, Managing for Results: Building on the Momentum for Strategic Human Capital Reform, GAO-02-528T (Washington, D.C.: Mar.
RECOGNITION (OR RECOGNIZE) - The term recognition, as used in this Statement, bears the same meaning as used by the Financial Accounting Standards Board in its conceptual statements.
The defenders responded vigorously, accounting for the lives of 226 British sailors and the removal of the lower part of Nelson’s saluting arm.
Loading...