Words similar to accounts
- accordionated
- account
- accountability
- accountant
- accountants
- accountants-
- accountants--no
- accountants-www
- accounted
- accounting
- accounting--it
- accountingrelated
- accounts
- accounts--and
- accounts--even
- accounts-and
- accounts-discussed
- accounts-to
- accra
- accreditation
- accrual
- acctcccaaactatagattgggtg
- acctgcactc
- acctran
- accttattttaaaaataaagttaa-
- accuweather
Example sentences for: accounts
How can you use “accounts” in a sentence? Here are some example sentences to help you improve your vocabulary:
The WP front reports that Australian investigators operating as part of the peacekeeping forces in East Timor are beginning to arrive at an understanding of why, despite eyewitness accounts of the mass murder of independence advocates by Indonesia-affiliated militias, they have found very little murder evidence.
Interest on uninvested funds received by direct loan and guaranteed loan financing accounts.
The alignment in figure 9accounts for each of these clones as well as additional exons predicted in the mouse from inter-genome comparisons.
This cultural-differences explanation certainly accounts for why anorexia nervosa is mainly a disease of higher-income girls and young women.
The same accounting that is used for post-1991 direct loans is also used for pre-1992 direct loans that were modified and transferred to financing accounts; loans receivable arising from defaulted post-1991 guaranteed loans; and loans receivable arising from defaulted pre-1992 guaranteed loans that were modified and transferred to financing accounts.
Loading...