Words similar to pbs

Example sentences for: pbs

How can you use “pbs” in a sentence? Here are some example sentences to help you improve your vocabulary:

Ken Bode, moderator of PBS' journalists round-table, Washington Week in Review , spelled out the case for defilement right after the story broke that big-time campaign money would get you booked overnight with Honest Abe.
The pegs were blocked with 14 ml of phosphate buffered saline (PBS) pH 7.0 in 1.0% Tween-20 and immersed in wells containing 0.1 ml serum.
This is true, say Michael Bechloss (NBC's Meet the Press ), Bill Kristol ( This Week ), and Mark Shields (PBS's NewsHour With Jim Lehrer ). The reason is that people are generally quite content, say Kristol and Doyle McManus ( Washington Week in Review )--incumbents don't want to rock the boat.
To make pBS1, the oligonucleotides 5'ACCTCCCAAACTATAGATTGGGTG 3'and 5'CGGCCAGAGTCGACTCACATATTG 3'were used to amplify a 1370 bp fragment from pTU23.
Rabbit polyclonal antibody against RSV-P protein has been described [ 21 ] . Indirect immunofluorescence and nuclear staining with DAPI was performed essentially as described previously [ 33 ] . A549 cells in monolayer, grown on cover slips, were washed in PBS and fixed in ice-cold 10% trichloracetic acid for 15 min, followed by successive washes in cold 70%, 90% and absolute ethanol for 3 min each.