Words similar to pb

Example sentences for: pb

How can you use “pb” in a sentence? Here are some example sentences to help you improve your vocabulary:

¶ V Pb
1D) shows that pericytes secrete intercellular vesicles, which migrate among basal epithelial cells to the b/pb interface, where they collapse into empty structures ("spikes").
Plasmids pB32 and pB86, carrying H109A and H109D alleles of HNT2 , were constructed by site-directed mutagenesis [ 49 ] of plasmid pB05 using primers PB3 (5'ATAATGTGTGTAGCCAAGTGGGGT) and PB4 (5'TAATGTGTGTATCCAAGTGGGGTAC).
4shows pb/im interface in detail, with HLA-DR MDC (A), CD8 T cells (B) and both (C).
The concentration of the metals, Al, As, Cr, Co, Cu, Fe, Pb, Ni, and Zn, expressed as total metal, should not exceed 1 µg/L each, and Cd, Hg, and Ag, expressed as total metal, should not exceed 100 ng/L each.