Words similar to pb

Example sentences for: pb

How can you use “pb” in a sentence? Here are some example sentences to help you improve your vocabulary:

PB and RN supervised the work.
1A) shows that this marker of proliferation is expressed in the nuclei of parabasal cells adjacent to the b/pb interface.
Pb qian
1E), toward the pb/im interface (dashed line).
Plasmids pB32 and pB86, carrying H109A and H109D alleles of HNT2 , were constructed by site-directed mutagenesis [ 49 ] of plasmid pB05 using primers PB3 (5'ATAATGTGTGTAGCCAAGTGGGGT) and PB4 (5'TAATGTGTGTATCCAAGTGGGGTAC).