Words similar to tn

Example sentences for: tn

How can you use “tn” in a sentence? Here are some example sentences to help you improve your vocabulary:

To determine whether cCAF stimulates fibroblasts to produce increased levels of Colls I and III, we treated cultures as for TN.
Sections were incubated with anti-FN or anti-TN antibodies (1:50) in 1% BSA in PBS for 2 hr at room temperature.
The test accuracy, the proportion of all tests that gave correct result, was defined as (TP + TN) / numbers of all tests.
A Xho1/HindIII (blunt) cassette containing the Tn5 neomycin phosphotransferase ( Neo )gene, that could confer resistance to G418 and whose expression in mammalian cells was directed by a phosphoglycerate kinase-1 ( pgk) promoter, was introduced into an XbaI (blunt) site between the Hnf3α genomic sequences [ 16, 25].
Primers used for TN amplification: sense 5'AAATGCATCTGCGAGGGC, antisense 5"GGAAGCTTGTTATTGCAGTCCTTCGG [ 41 ] .