Words similar to tmod

Example sentences for: tmod

How can you use “tmod” in a sentence? Here are some example sentences to help you improve your vocabulary:

The genomic organization between YL-1 and TMOD4 clearly raises the possibility of additional proteins being produced from intergenic transcripts.
3' RACE from TMOD4 exon 2 extended our reported cDNA by an additional 9 bp, bringing the entire length of the TMOD4 transcript to 1.267 kb (Genbank Accession# AF393374).
1 5'GGACTAAGACAACGTGACCAGACA3', and TMOD4EX2RACE3' .2 5'GAGGCCCTTTTGCAGTACTTGG3'.
We used Clontech's Human Heart Marathon-Ready cDNA (Cat # 7404-1) to perform 5' and 3' RACE to the TMOD4 gene.
The exon/intron boundaries of the two genes are conserved, except that TMOD2 has more 5' untranslated region (UTR) in coding exon 1 and more 3' UTR in exon 9 than TMOD4.