Words similar to tmod

Example sentences for: tmod

How can you use “tmod” in a sentence? Here are some example sentences to help you improve your vocabulary:

2. RACE products were then subcloned and identified by using either a 5' or 3' probes made from the TMOD4 cDNA.
1 5'TACAGGAAAGGAGGACAGATGAGG3', and TMOD4EX9RACE5'.
We were able to align this sequence and found that it lies 1006 bp from TMOD4 exon 1 and contained a consensus donor splice site.
Tropomodulin 1 (TMOD1) is widespread in heart, muscle, brain, lens, erythrocytes, and arterioles; Tropomodulin 2 (TMOD2) is restricted to neuronal tissue; Tropomodulin 4 (TMOD4).
YL-1 endogenous frame we find that this ORF terminates in TMOD4 exon 1. If we assume an ORF including YL-1 exons 1-3 along with the isolated RACE product, then it would theoretically produce a protein of 264 amino acids.