Words similar to tmod

Example sentences for: tmod

How can you use “tmod” in a sentence? Here are some example sentences to help you improve your vocabulary:

Thus, further analysis will be needed to determine if any of the YL-1/TMOD4 intergenic transcripts play an important biological role either at the RNA or protein levels.
The distance from the last exon of YL-1 to E0 TMOD4 is 291 bp.
Our reported cDNAs have 69 and 19 bp additional sequence 5' to what is contained in exon 1 for each gene, respectively [ 8 ] . A search of the EST database using the TMOD4 5' end extended this sequence by 8 bp (ESTs AA194560, AA192772, and AA178988).
The initial RACE reaction to identify intergenic RACE products was performed using the gene specific primer, TMOD4RACE5'.
1 5'TACAGGAAAGGAGGACAGATGAGG3', and TMOD4EX9RACE5'.