Words similar to pr

Example sentences for: pr

How can you use “pr” in a sentence? Here are some example sentences to help you improve your vocabulary:

This conclusion is consistent with the original interpretation of PR gene expression data in eds5 and sid2 mutants that PR-1 and PR-5 are regulated differently [ 20 ] .
You gotta wonder if the PR firm that wrote the press release touting Athlon wasn't tempted to add: 'No, really.
All the women on the list are, says the company's PR sheet, "accomplished, fashionable and beautiful."
This sort of program is much more than a PR gimmick.
Primers to amplify regions without an Rsa I site were designed for two stress-induced genes, the pathogen-inducible PR1 gene (PR1-F: ATGAATTTTACTGGCTATTC; PR1-R: AACCCACATGTTCACGGCGGA), the O 3 -inducible amino-cyclopropane-carboxylate (ACC) synthase gene, ACS6 (ACS6-F: CATAAGTGTTGCGGAAGTAA; ACS6-R: GGCAATGGAACGAACC) and the jasmonate-inducible defensin gene, PDF1.