Example sentences for: prp

How can you use “prp” in a sentence? Here are some example sentences to help you improve your vocabulary:

  • The aggregates of PrP Sc can proliferate within cells and be transmitted to other cells and tissues, leading to the spread of neurotoxicity.

  • The transgene was detected by PCR amplification of a 200 bp product using a forward primer located in the β-catenin cDNA sequence (βcat3pb: 5' TCGTTCTTTTCACTCTGGTGGAT 3') and a reverse primer in the PrP promoter (PrP-S: 5' GTGGATACCCCCTCCCCCAGCCTAGACC 3').

  • The molecular nature of distinct PrP Sc strains is determined by specific stable conformations of PrP.

  • A 750 bp control band was produced by amplification from the endogenous PrP gene using PrP-S and the reverse primer (PrP-AS: 5' CCTCTTTGTGACTATGTGGACTGATGTCGG 3').

  • In order to avoid possible in utero lethality caused by excess pathway activity, we used the murine PrP promoter element to construct our transgenic lines.


How many words do you know? Try our free vocabulary size test!


Search

Search for example sentences

Loading Loading...
Quantcast