Words similar to prp

Example sentences for: prp

How can you use “prp” in a sentence? Here are some example sentences to help you improve your vocabulary:

Interestingly, the mammalian PrP Sc is fundamentally different from yeast prions, since it lacks a Q/N-rich domain, indicating that distinct structural features are responsible for its ability to form self-propagating aggregates.
The aggregates of PrP Sc can proliferate within cells and be transmitted to other cells and tissues, leading to the spread of neurotoxicity.
As with PrP Sc , yeast prions efficiently recruit soluble molecules of the same species, thus inactivating them (Lindquist 1997; Chernoff 2001; Wickner et al.
The molecular nature of distinct PrP Sc strains is determined by specific stable conformations of PrP.
The transgene was detected by PCR amplification of a 200 bp product using a forward primer located in the β-catenin cDNA sequence (βcat3pb: 5' TCGTTCTTTTCACTCTGGTGGAT 3') and a reverse primer in the PrP promoter (PrP-S: 5' GTGGATACCCCCTCCCCCAGCCTAGACC 3').