Words similar to prp

Example sentences for: prp

How can you use “prp” in a sentence? Here are some example sentences to help you improve your vocabulary:

In order to avoid possible in utero lethality caused by excess pathway activity, we used the murine PrP promoter element to construct our transgenic lines.
The abnormal aggregated species can recruit normal soluble PrP molecules into aggregates, thus inactivating them.
These “variants” of yeast prions are analogous to different prion “strains” of PrP Sc , which cause versions of the disease with different incubation periods and different patterns of brain pathology.
Interestingly, the mammalian PrP Sc is fundamentally different from yeast prions, since it lacks a Q/N-rich domain, indicating that distinct structural features are responsible for its ability to form self-propagating aggregates.
A 750 bp control band was produced by amplification from the endogenous PrP gene using PrP-S and the reverse primer (PrP-AS: 5' CCTCTTTGTGACTATGTGGACTGATGTCGG 3').