Words similar to prp

Example sentences for: prp

How can you use “prp” in a sentence? Here are some example sentences to help you improve your vocabulary:

These “variants” of yeast prions are analogous to different prion “strains” of PrP Sc , which cause versions of the disease with different incubation periods and different patterns of brain pathology.
The transgene was detected by PCR amplification of a 200 bp product using a forward primer located in the β-catenin cDNA sequence (βcat3pb: 5' TCGTTCTTTTCACTCTGGTGGAT 3') and a reverse primer in the PrP promoter (PrP-S: 5' GTGGATACCCCCTCCCCCAGCCTAGACC 3').
Wnt signaling is known to play a critical role in the development of the brain, and the midbrain and cerebellum do not form in animals lacking Wnt-1 [ 23 ] . Furthermore, targeted disruption of the frizzled-4 gene results in cerebellar abnormalities in mice [ 24 ] . Transgene expression from the PrP promoter is extremely low during embryonic development, with high-level postnatal expression largely restricted to neurons and glia of the CNS [ 25 ] . Transgenic mice expressing either wild-type or mutant β-catenin were generated so that a range of pathway activation could be examined.
A 750 bp control band was produced by amplification from the endogenous PrP gene using PrP-S and the reverse primer (PrP-AS: 5' CCTCTTTGTGACTATGTGGACTGATGTCGG 3').
The abnormal aggregated species can recruit normal soluble PrP molecules into aggregates, thus inactivating them.