Words similar to prp

Example sentences for: prp

How can you use “prp” in a sentence? Here are some example sentences to help you improve your vocabulary:

These “variants” of yeast prions are analogous to different prion “strains” of PrP Sc , which cause versions of the disease with different incubation periods and different patterns of brain pathology.
The aggregates of PrP Sc can proliferate within cells and be transmitted to other cells and tissues, leading to the spread of neurotoxicity.
The transgene was detected by PCR amplification of a 200 bp product using a forward primer located in the β-catenin cDNA sequence (βcat3pb: 5' TCGTTCTTTTCACTCTGGTGGAT 3') and a reverse primer in the PrP promoter (PrP-S: 5' GTGGATACCCCCTCCCCCAGCCTAGACC 3').
As with PrP Sc , yeast prions efficiently recruit soluble molecules of the same species, thus inactivating them (Lindquist 1997; Chernoff 2001; Wickner et al.
Wnt signaling is known to play a critical role in the development of the brain, and the midbrain and cerebellum do not form in animals lacking Wnt-1 [ 23 ] . Furthermore, targeted disruption of the frizzled-4 gene results in cerebellar abnormalities in mice [ 24 ] . Transgene expression from the PrP promoter is extremely low during embryonic development, with high-level postnatal expression largely restricted to neurons and glia of the CNS [ 25 ] . Transgenic mice expressing either wild-type or mutant β-catenin were generated so that a range of pathway activation could be examined.