Words similar to prp-s
Example sentences for: prp-s
How can you use “prp-s” in a sentence? Here are some example sentences to help you improve your vocabulary:
A 750 bp control band was produced by amplification from the endogenous PrP gene using PrP-S and the reverse primer (PrP-AS: 5' CCTCTTTGTGACTATGTGGACTGATGTCGG 3').
The transgene was detected by PCR amplification of a 200 bp product using a forward primer located in the β-catenin cDNA sequence (βcat3pb: 5' TCGTTCTTTTCACTCTGGTGGAT 3') and a reverse primer in the PrP promoter (PrP-S: 5' GTGGATACCCCCTCCCCCAGCCTAGACC 3').