Words similar to pdh

Example sentences for: pdh

How can you use “pdh” in a sentence? Here are some example sentences to help you improve your vocabulary:

Removing the G6PDH from the metabolic network eliminated all metabolic pathways that utilized the oxidative branch of the PPP.
, less than 100 nM) can selectively suppress HIV-1 transcript elongation without altering cellular transcripts in cell types of various lineages, including podocytes [ 7 29 30 ] . Cyclin D 1 transcript levels were followed before, during, and after treatment of confluent wild-type or HIV-1 infected podocytes with 50 nM flavopiridol, a dose that suppresses HIV-1 transcription by 70% [ 7 ] . Analysis of HIV-1, cyclin D 1 , and glyceraldehyde-3-phosphate dehydrogenase (G3PDH) transcript levels in podocytes treated with flavopiridol for 2 days, followed by drug washout for 1 day, showed that cyclin D 1 expression paralleled HIV-1 expression in infected podocytes before, during and after suppression of HIV-1 genes (Figure 4).
zwf : zwf codes for glucose-6-phosphate dehydrogenase (G6PDH), the first enzyme in the oxidative branch of the PPP.
Amplification of the housekeeping gene G3PDH served as a control for RNA integrity.
G3PDH gene fragment of approximately 300 bp was amplified with G3PDH 3' and 5' primers (GAPA-F: GGTAGGATCGGGAGGAAC; GAPA-R: GATAACCTTCTTGGCACCAG) using the adaptor-ligated cDNA as template.