Words similar to pdh

Example sentences for: pdh

How can you use “pdh” in a sentence? Here are some example sentences to help you improve your vocabulary:

Glyceraldehyde-3-phosphate dehydrogenase (G3PDH), β-actin, and α-tubulin increased in both age groups following fracture.
The amplimers were UV cross-linked and hybridized with Rapid-Hyb buffer (Amersham) at 42°C using γ- 32P ATP end-labeled oligonucleotides (Table 1, G3PDH probe from Clontech) as probes.
Glyceraldehyde-3-phosphate dehydrogenase (G3PDH)
G3PDH gene fragment of approximately 300 bp was amplified with G3PDH 3' and 5' primers (GAPA-F: GGTAGGATCGGGAGGAAC; GAPA-R: GATAACCTTCTTGGCACCAG) using the adaptor-ligated cDNA as template.
Following Northern hybridization with these probes, the blots were stripped and re-probed with a mouse G3PDH probe for normalization purposes.