Words similar to pdh

Example sentences for: pdh

How can you use “pdh” in a sentence? Here are some example sentences to help you improve your vocabulary:

G3PDH transcripts from both cell lines were analyzed on a 2% agarose gel only.
RNA and protein samples were analyzed as follows: Podocyte RNA (10 μg) was analyzed by northern blot using probes for HIV-1 nef-LTR [ 7 ] , mouse cyclin D 1 (cDNA generated by RT-PCR from mouse podocytes and verified by sequence analysis), synaptopodin [ 7 ] , and G3PDH.
Following Northern hybridization with these probes, the blots were stripped and re-probed with a mouse G3PDH probe for normalization purposes.
A normalized value was obtained by dividing the target cDNA amount by the g3pdh reference.
G3PDH gene fragment of approximately 300 bp was amplified with G3PDH 3' and 5' primers (GAPA-F: GGTAGGATCGGGAGGAAC; GAPA-R: GATAACCTTCTTGGCACCAG) using the adaptor-ligated cDNA as template.