Words similar to pdf

Example sentences for: pdf

How can you use “pdf” in a sentence? Here are some example sentences to help you improve your vocabulary:

Primers to amplify regions without an Rsa I site were designed for two stress-induced genes, the pathogen-inducible PR1 gene (PR1-F: ATGAATTTTACTGGCTATTC; PR1-R: AACCCACATGTTCACGGCGGA), the O 3 -inducible amino-cyclopropane-carboxylate (ACC) synthase gene, ACS6 (ACS6-F: CATAAGTGTTGCGGAAGTAA; ACS6-R: GGCAATGGAACGAACC) and the jasmonate-inducible defensin gene, PDF1.
We verified the location of CARD15 on our map by amplifying a 444 bp fragment of exon 4 from clone 327F22 in our map (see additional data file 1, blau_map.pdf).
G3.pdf
The FPC database has few clones from the CITB library and none that corresponded to the clones on our map (see additional data file 1, blau_map.pdf).
Students have been reading primary research papers since well before PDF files became available, but the increased access to papers online and the improved quality of the format has significantly enhanced the use of research and review papers in the undergraduate curriculum.