Words similar to gat
- g-g---
- g-moms
- g-n-t-r
- g-zipped
- g. trent
- gas
- gasb
- gasb--governmental
- gasoline
- gassoc
- gastritis
- gastrocnemius
- gastroenterology
- gastrointestinal
- gastroparesis
- gastropathy
- gastrula
- gastrulation
- gaststätte
- gasworks
- gat
- gata
- gata-
- gata-binding
- gataaa
- gataaccttcttggcaccag
- gatas
- gataway
- gatcctcgagatcgataccgtcgagctagcgtagtctgggacgtcgtatgggtatcgactcatattcgagatatttgattataccaaggc-
- gatcctcgagttacattggttttatatctggg
- gatcggtaccattagcacggtgccttaacca-
- gatch
- gate
- gatekeeper
- gatekeepers
- gb
- gc
- gdna
- gdpb
- ggg
Example sentences for: gat
How can you use “gat” in a sentence? Here are some example sentences to help you improve your vocabulary:
66: CTA G AG GGG AAT TGT TAT CCG CTC ACA ATT CCC CTA TAG TGN NNN GTA TTA ATT TCG CGG GAT CGA (XbaI site in bold; N indicates a random sequence region)
80: C GCT ATC cTT GTT GGT GTT gAT GGT AGG NNN TAA NNN GAA CTG cCC GAG GAA CAT CAG NNN CAA GCG CGT CTG AAT AGG C (regions 2241-2244, 2266-2268, 2272-2274 are randomized, silent mutations are in lower case)
A cDNA that encodes a hemagglutinin-tagged NPM3 protein was produced by PCR under the following conditions: 100 μl reactions with 1X Pfu buffer, 0.2 mM deoxyribonucleotides, 1 μM HA-F primer (5'-AAA GAA TTC AGC ATG TAC CCA TAC GAC GTC CCA GAC TAC GCC GCC GCC GGT ACT GCA GCT GCC-3'), 1 μM NPM3 -R2 primer (5'-AAA GAA TTC CTA GGG CCT GCC CCC CTG CTT TTT GGC AGG AAG GAT GGG-3'), 1 ng of human NPM3 cDNA insert, and 2.5 Units of recombinant Pfu DNA Polymerase.
Fine sandy beaches are close by at Cala Gat and Cala Moltó, though most of the bathers head to Platja Son Moll, lined by large hotels.
Binding reactions were carried out at room temperature for 30 min in a total volume of 15 μl and contained 2-5 μg of nuclear extracts, 5 μl of 5X gel shift binding buffer (20% glycerol, 5 mM MgCl 2 , 2.5 mM EDTA, 2.5 mM DTT, 250 mM NaCl, 50 mM Tris-HCl, pH 7.5), 2 μg poly (dI-dC) and 3 × 10 4cpm/μl of [ 32P] labeled CREB (5'-AGA GAT TGC CTG ACG TCA GAG AGC TAG-3'), NF-κB (5'-AGT TGA GGG GAC TTT CCC AGG C-3') (Promega Gel Shift Assay Systems, Madison, WI, USA) or CCAAT/enhancer binding protein (C/EBP) (5'-TGC AGA TTG CGC AAT CTG CA-3') (Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA) oligonucleotides.
Loading...