Words similar to gat
- g-g---
- g-moms
- g-n-t-r
- g-zipped
- g. trent
- gas
- gasb
- gasb--governmental
- gasoline
- gassoc
- gastritis
- gastrocnemius
- gastroenterology
- gastrointestinal
- gastroparesis
- gastropathy
- gastrula
- gastrulation
- gaststätte
- gasworks
- gat
- gata
- gata-
- gata-binding
- gataaa
- gataaccttcttggcaccag
- gatas
- gataway
- gatcctcgagatcgataccgtcgagctagcgtagtctgggacgtcgtatgggtatcgactcatattcgagatatttgattataccaaggc-
- gatcctcgagttacattggttttatatctggg
- gatcggtaccattagcacggtgccttaacca-
- gatch
- gate
- gatekeeper
- gatekeepers
- gb
- gc
- gdna
- gdpb
- ggg
Example sentences for: gat
How can you use “gat” in a sentence? Here are some example sentences to help you improve your vocabulary:
The HCMV DNA was detected using HCMV1 (5' cct agt gtg gat gac cta cgg gcc a) and HCMV2 (5' cag aca cag tgt cct ccc gct cct c) primers producing 249 bp long amplicon and the DNA of HHV6 was amplified with specific primer pair HP0 (5' ccg caa tcg aat cca cct agc gg) and HP4 (5' gtg aga acg gat tcg aac agt gct g) yielding 440 bp product [ 23 24 ] . All amplifications were carried out with 20 pmol of each primer in 2 mM solution of MgCl 2 , 2 U of Tag Special DNA polymerase (Biovendor, Czech Republic), 0.3 mM of each dNTPs, 10× reaction buffer and 1 μg of isolated DNA according to the following conditions: 96°C for 4 min, (94°C for 10 sec, 58°C for 10 sec, 72°C for 20 sec) 36 times, and final extension at 72°C for 2 min.
1 M), d(GAT)TP (25 mM), dCTP (1 mM), Cy3-dCTP (2 mM)(Amersham, Piscataway, NJ) and Superscript RT II (200 units) were added and incubated at room temperature for 10 minutes and then at 42°C for 2 hours.
The introns were PCR-amplified with KM37 (GAT AAT ACG ACT CAC TAT AAT GGC ATT ACC GCC TTG T) and GM24 (GCT CTA GAC TTA GCT ACA ATA TGA AC) in 25 μl reactions under the conditions stated above and cycled 20 times.
A cDNA that encodes a hemagglutinin-tagged NPM3 protein was produced by PCR under the following conditions: 100 μl reactions with 1X Pfu buffer, 0.2 mM deoxyribonucleotides, 1 μM HA-F primer (5'-AAA GAA TTC AGC ATG TAC CCA TAC GAC GTC CCA GAC TAC GCC GCC GCC GGT ACT GCA GCT GCC-3'), 1 μM NPM3 -R2 primer (5'-AAA GAA TTC CTA GGG CCT GCC CCC CTG CTT TTT GGC AGG AAG GAT GGG-3'), 1 ng of human NPM3 cDNA insert, and 2.5 Units of recombinant Pfu DNA Polymerase.
Point mutations were introduced into Rlk-GFP by a PCR based strategy [ 53] with oligonucleotides encoding the required mutations (Mutated residues are in bold): Y420F (GGAC GAT GAA T TC ATC AGT TCT TCT G), Y91F (GTC AAG GCT CTT T T T GAC TTC CTG CC).