Words similar to gatcctcgagttacattggttttatatctggg
Example sentences for: gatcctcgagttacattggttttatatctggg
How can you use “gatcctcgagttacattggttttatatctggg” in a sentence? Here are some example sentences to help you improve your vocabulary:
A fragment containing the PPT1 ORF was excised from the pBII-PPT1 using Eco RI and Xho I restriction enzymes and was subcloned downstream of the GST coding region into the Eco RI and Sal I sites of the bacterial expression vector pET-21a GST [ 37 ] . To construct the pET-GST-PPT1 (1-504) plasmid a 453 bp fragment was amplified from pET-GST-PPT1 by PCR using a 3' primer containing a Xho I restriction site and a stop codon designed to truncate the PPT1 gene product at Met504 (5'-gatcctcgagTTAcattggttttatatctggg) and a 5' primer (5'-gtaatgcatggtggttta) encompassing the Nsi I restriction site of PPT1 . The PCR product was cloned into the Nsi I and Xho I restriction sites of pET-GST-PPT1 and sequenced.
Loading...