Words similar to gata
- gasb
- gasb--governmental
- gasoline
- gassoc
- gastropathy
- gastrula
- gastrulation
- gasworks
- gat
- gata
- gata-
- gata-binding
- gataa
- gataaa
- gataaccttcttggcaccag
- gataway
- gatcctcgagatcgataccgtcgagctagcgtagtctgggacgtcgtatgggtatcgactcatattcgagatatttgattataccaaggc-
- gatcctcgagttacattggttttatatctggg
- gatcggtaccattagcacggtgccttaacca-
- gate
Example sentences for: gata
How can you use “gata” in a sentence? Here are some example sentences to help you improve your vocabulary:
Numbers of STRPs, heterozygosity values, and sex-average genetic map properties for Screening Sets 12, 52, and 12 plus 52 combined, broken down by chromosome, are displayed in Table 2. Of the 39 total X chromosome STRPs in the combined Sets, 3 (GATA2A12, GGAT3F08, and GATA42G01) are in the pter pseudoautosomal region, and 1 (SDF1) is in the qter pseudoautosomal region.
On the other hand, the readings o(i), yasu(ku), na(ri) and gata(shi) , are unrelated to Chinese lăo, yì, chéng , and nán .
\?\ gata(shi)
As two examples for STRPs on chromosome 1 in Set 12: GATA26G09N indicates that one of the original primers for GATA26G09 was changed to correct a sequencing error without change in allele sizes, and GGAA3A07Z indicates that one of the primers for GGAA3A07 was shifted along the chromosome resulting in different allele sizes.
The transcription factors (GATA, Friend-of-GATA, and Runx family proteins) and signal transduction pathways (Toll/NF-κB, Serrate/Notch, and JAK/STAT) that are required for specification and proliferation of blood cells during normal hematopoiesis, as well as during the hematopoietic proliferation that accompanies immune challenge, are conserved (Evans et al.
Loading...