Words similar to gata
- gasb
- gasb--governmental
- gasoline
- gassoc
- gastropathy
- gastrula
- gastrulation
- gasworks
- gat
- gata
- gata-
- gata-binding
- gataa
- gataaa
- gataaccttcttggcaccag
- gataway
- gatcctcgagatcgataccgtcgagctagcgtagtctgggacgtcgtatgggtatcgactcatattcgagatatttgattataccaaggc-
- gatcctcgagttacattggttttatatctggg
- gatcggtaccattagcacggtgccttaacca-
- gate
Example sentences for: gata
How can you use “gata” in a sentence? Here are some example sentences to help you improve your vocabulary:
As just one example, AGAT repeats can also be presented as GATA, ATAG, TAGA, ATCT, TATC, CTAT, and TCTA repeats.
For example, we have observed apparent null alleles for some STRPs in Chinese that were not present in Europeans (eg GATA29A01 on chromosome 6 and GGAA20G04 on chromosome 2).
As two examples for STRPs on chromosome 1 in Set 12: GATA26G09N indicates that one of the original primers for GATA26G09 was changed to correct a sequencing error without change in allele sizes, and GGAA3A07Z indicates that one of the primers for GGAA3A07 was shifted along the chromosome resulting in different allele sizes.
The second and proximal region of deletion spans 6 markers (D5S406, GATA82H02, D5S1455, D5S2054, D5S635 and D5S676), and was deleted in 28 tumors.
Numbers of STRPs, heterozygosity values, and sex-average genetic map properties for Screening Sets 12, 52, and 12 plus 52 combined, broken down by chromosome, are displayed in Table 2. Of the 39 total X chromosome STRPs in the combined Sets, 3 (GATA2A12, GGAT3F08, and GATA42G01) are in the pter pseudoautosomal region, and 1 (SDF1) is in the qter pseudoautosomal region.
Loading...