Words similar to gata
- gasb
- gasb--governmental
- gasoline
- gassoc
- gastropathy
- gastrula
- gastrulation
- gasworks
- gat
- gata
- gata-
- gata-binding
- gataa
- gataaa
- gataaccttcttggcaccag
- gataway
- gatcctcgagatcgataccgtcgagctagcgtagtctgggacgtcgtatgggtatcgactcatattcgagatatttgattataccaaggc-
- gatcctcgagttacattggttttatatctggg
- gatcggtaccattagcacggtgccttaacca-
- gate
Example sentences for: gata
How can you use “gata” in a sentence? Here are some example sentences to help you improve your vocabulary:
On the other hand, the readings o(i), yasu(ku), na(ri) and gata(shi) , are unrelated to Chinese lăo, yì, chéng , and nán .
The text would thus be read shōnen o(i) yasu(ku), gaku na(ri) gata(shi) , which retains the meaning of the original, as much as any translation can.
As two examples for STRPs on chromosome 1 in Set 12: GATA26G09N indicates that one of the original primers for GATA26G09 was changed to correct a sequencing error without change in allele sizes, and GGAA3A07Z indicates that one of the primers for GGAA3A07 was shifted along the chromosome resulting in different allele sizes.
The transcription factors (GATA, Friend-of-GATA, and Runx family proteins) and signal transduction pathways (Toll/NF-κB, Serrate/Notch, and JAK/STAT) that are required for specification and proliferation of blood cells during normal hematopoiesis, as well as during the hematopoietic proliferation that accompanies immune challenge, are conserved (Evans et al.
\?\ gata
Loading...