Words similar to gata
- gasb
- gasb--governmental
- gasoline
- gassoc
- gastropathy
- gastrula
- gastrulation
- gasworks
- gat
- gata
- gata-
- gata-binding
- gataa
- gataaa
- gataaccttcttggcaccag
- gataway
- gatcctcgagatcgataccgtcgagctagcgtagtctgggacgtcgtatgggtatcgactcatattcgagatatttgattataccaaggc-
- gatcctcgagttacattggttttatatctggg
- gatcggtaccattagcacggtgccttaacca-
- gate
Example sentences for: gata
How can you use “gata” in a sentence? Here are some example sentences to help you improve your vocabulary:
As just one example, AGAT repeats can also be presented as GATA, ATAG, TAGA, ATCT, TATC, CTAT, and TCTA repeats.
We have also observed non-integer alleles in Sub-Saharan Africans that have not been seen at appreciable frequency in other populations (eg GATA104 on chromosome 7 and GATA11A06 on chromosome 18).
\?\ gata
As two examples for STRPs on chromosome 1 in Set 12: GATA26G09N indicates that one of the original primers for GATA26G09 was changed to correct a sequencing error without change in allele sizes, and GGAA3A07Z indicates that one of the primers for GGAA3A07 was shifted along the chromosome resulting in different allele sizes.
For example, we have observed apparent null alleles for some STRPs in Chinese that were not present in Europeans (eg GATA29A01 on chromosome 6 and GGAA20G04 on chromosome 2).
Loading...