Words similar to gata
- gasb
- gasb--governmental
- gasoline
- gassoc
- gastropathy
- gastrula
- gastrulation
- gasworks
- gat
- gata
- gata-
- gata-binding
- gataa
- gataaa
- gataaccttcttggcaccag
- gataway
- gatcctcgagatcgataccgtcgagctagcgtagtctgggacgtcgtatgggtatcgactcatattcgagatatttgattataccaaggc-
- gatcctcgagttacattggttttatatctggg
- gatcggtaccattagcacggtgccttaacca-
- gate
Example sentences for: gata
How can you use “gata” in a sentence? Here are some example sentences to help you improve your vocabulary:
The text would thus be read shōnen o(i) yasu(ku), gaku na(ri) gata(shi) , which retains the meaning of the original, as much as any translation can.
On the other hand, the readings o(i), yasu(ku), na(ri) and gata(shi) , are unrelated to Chinese lăo, yì, chéng , and nán .
The second and proximal region of deletion spans 6 markers (D5S406, GATA82H02, D5S1455, D5S2054, D5S635 and D5S676), and was deleted in 28 tumors.
As just one example, AGAT repeats can also be presented as GATA, ATAG, TAGA, ATCT, TATC, CTAT, and TCTA repeats.
As two examples for STRPs on chromosome 1 in Set 12: GATA26G09N indicates that one of the original primers for GATA26G09 was changed to correct a sequencing error without change in allele sizes, and GGAA3A07Z indicates that one of the primers for GGAA3A07 was shifted along the chromosome resulting in different allele sizes.
Loading...