Words similar to gataaccttcttggcaccag

Example sentences for: gataaccttcttggcaccag

How can you use “gataaccttcttggcaccag” in a sentence? Here are some example sentences to help you improve your vocabulary:

G3PDH gene fragment of approximately 300 bp was amplified with G3PDH 3' and 5' primers (GAPA-F: GGTAGGATCGGGAGGAAC; GAPA-R: GATAACCTTCTTGGCACCAG) using the adaptor-ligated cDNA as template.