Words similar to pce
Example sentences for: pce
How can you use “pce” in a sentence? Here are some example sentences to help you improve your vocabulary:
Here we constructed pct1Δ and pce1Δ plasmids containing 5' and 3' flanking genomic sequences in which the entire triphosphatase or guanylyltransferase coding sequence was deleted and replaced by the kanamycin resistance gene [ 17 ] . The pct1::kanMX and pce1::kanMX constructs were transformed separately into a diploid strain of S. pombe and chromosomal integrants containing one copy of the wild-type gene and one of pct1::kanMX or pce1::kanMX were selected on medium containing G418.
The pct1 +and pce1 +cDNAs were cloned separately into the S. pombe expression vector pREP41X ( LEU2 ars1 +) so as to place them under the control of the nmt1* promoter.
2 kb upstream of the translation start codon of pct1 +or pce1 +; L2, a 40-mer in which 20 bases were identical to the 5' sequence of pFA6a-KanMX4 (GCTTCAGCTGGCGGCCGCGT) and 20 bases were identical to the antisense strand sequence immediately 5' of the translation start site of pct1 +or pce1 +; L3, a 40-mer in which 20 bases were identical to the 3' sequence of pFA6a-KanMX4 (AGTGGCCTATGCGGCCGCGG) and 20 bases corresponded to the sense-strand sequence immediately 3' of the stop codon of
S. pombe RNA triphosphatase Pct1 is a 303-amino acid polypeptide with a homodimeric quaternary structure [ 12 ] . The pct1 +gene contains a single intron within the open reading frame [ 12 ] . S. pombe RNA guanylyltransferase Pce1 is a 402-amino acid monomeric protein [ 20 ] ; there are no introns within the pce1 +gene.
Although recombinant Pct1 and Pce1 enzymes have been purified and characterized biochemically, and shown to function in cap formation when expressed in S. cerevisiae [ 12 20 21 ] , there have been no antecedent genetic studies of the essentiality of Pct1 or Pce1 in fission yeast.
Loading...