Words similar to pce
Example sentences for: pce
How can you use “pce” in a sentence? Here are some example sentences to help you improve your vocabulary:
2 kb upstream of the translation start codon of pct1 +or pce1 +; L2, a 40-mer in which 20 bases were identical to the 5' sequence of pFA6a-KanMX4 (GCTTCAGCTGGCGGCCGCGT) and 20 bases were identical to the antisense strand sequence immediately 5' of the translation start site of pct1 +or pce1 +; L3, a 40-mer in which 20 bases were identical to the 3' sequence of pFA6a-KanMX4 (AGTGGCCTATGCGGCCGCGG) and 20 bases corresponded to the sense-strand sequence immediately 3' of the stop codon of
S. pombe RNA triphosphatase Pct1 is a 303-amino acid polypeptide with a homodimeric quaternary structure [ 12 ] . The pct1 +gene contains a single intron within the open reading frame [ 12 ] . S. pombe RNA guanylyltransferase Pce1 is a 402-amino acid monomeric protein [ 20 ] ; there are no introns within the pce1 +gene.
The intron-less pce1 +gene was amplified from plasmid pl32-PCE1 [ 12 ] . The PCR products were digested with Xho I and Bam HI and then inserted into the S. pombe expression vector pREP41X ( LEU2 ars1 +) [ 19 ] . The inserts were sequenced to exclude the acquisition of unwanted mutations during the amplification and cloning steps.
We found for both knock-outs that 20 out of 20 tetrads yielded only 2 viable spores and all of the viable haploids were G418-sensitive, i.e., none contained the pct1::kanMX or pce1::kanMX alleles.
pct1 +or pce1 +; L4, a 20-mer corresponding to the antisense-strand sequence of the 3'-flanking region ~1 kb downstream of stop codon of pct1 +or pce1 +. In the first-stage PCR, a 5'-flanking fragment was synthesized using S. pombe genomic DNA as the template and LI plus L2 as primers.
Loading...