Words similar to pce
Example sentences for: pce
How can you use “pce” in a sentence? Here are some example sentences to help you improve your vocabulary:
The intron-less pce1 +gene was amplified from plasmid pl32-PCE1 [ 12 ] . The PCR products were digested with Xho I and Bam HI and then inserted into the S. pombe expression vector pREP41X ( LEU2 ars1 +) [ 19 ] . The inserts were sequenced to exclude the acquisition of unwanted mutations during the amplification and cloning steps.
2 kb upstream of the translation start codon of pct1 +or pce1 +; L2, a 40-mer in which 20 bases were identical to the 5' sequence of pFA6a-KanMX4 (GCTTCAGCTGGCGGCCGCGT) and 20 bases were identical to the antisense strand sequence immediately 5' of the translation start site of pct1 +or pce1 +; L3, a 40-mer in which 20 bases were identical to the 3' sequence of pFA6a-KanMX4 (AGTGGCCTATGCGGCCGCGG) and 20 bases corresponded to the sense-strand sequence immediately 3' of the stop codon of
These results show that the pct1Δ and pce1Δ strains are viable if the chromosomal deletions are complemented by an extrachromosomal triphosphatase or guanylyltransferase gene.
Here we constructed pct1Δ and pce1Δ plasmids containing 5' and 3' flanking genomic sequences in which the entire triphosphatase or guanylyltransferase coding sequence was deleted and replaced by the kanamycin resistance gene [ 17 ] . The pct1::kanMX and pce1::kanMX constructs were transformed separately into a diploid strain of S. pombe and chromosomal integrants containing one copy of the wild-type gene and one of pct1::kanMX or pce1::kanMX were selected on medium containing G418.
Expression of the capping enzymes from these plasmids is driven by the nmt1* promoter [ 19 ] . The plasmids were transformed into heterozygous pct1 +/ pct1::kanMX or pce1 +/ pct1::kanMX diploids using the lithium acetate method [ 18 ] . The Leu +diploid transformants were then sporulated on ME plates at room temperature.
Loading...