Words similar to pce

Example sentences for: pce

How can you use “pce” in a sentence? Here are some example sentences to help you improve your vocabulary:

We suspect that expression levels of the Pct1 or Pce1 enzymes in these strains exceeded a threshold required for cell viability.
The pct1 +and pce1 +cDNAs were cloned separately into the S. pombe expression vector pREP41X ( LEU2 ars1 +) so as to place them under the control of the nmt1* promoter.
These results show that the pct1Δ and pce1Δ strains are viable if the chromosomal deletions are complemented by an extrachromosomal triphosphatase or guanylyltransferase gene.
2 kb upstream of the translation start codon of pct1 +or pce1 +; L2, a 40-mer in which 20 bases were identical to the 5' sequence of pFA6a-KanMX4 (GCTTCAGCTGGCGGCCGCGT) and 20 bases were identical to the antisense strand sequence immediately 5' of the translation start site of pct1 +or pce1 +; L3, a 40-mer in which 20 bases were identical to the 3' sequence of pFA6a-KanMX4 (AGTGGCCTATGCGGCCGCGG) and 20 bases corresponded to the sense-strand sequence immediately 3' of the stop codon of
Similarly, half of the Leu +haploids derived from a pce +/ pce1::kanMX strain containing the pce1 +plasmid were resistant to G418.