Words similar to pce
Example sentences for: pce
How can you use “pce” in a sentence? Here are some example sentences to help you improve your vocabulary:
2 kb upstream of the translation start codon of pct1 +or pce1 +; L2, a 40-mer in which 20 bases were identical to the 5' sequence of pFA6a-KanMX4 (GCTTCAGCTGGCGGCCGCGT) and 20 bases were identical to the antisense strand sequence immediately 5' of the translation start site of pct1 +or pce1 +; L3, a 40-mer in which 20 bases were identical to the 3' sequence of pFA6a-KanMX4 (AGTGGCCTATGCGGCCGCGG) and 20 bases corresponded to the sense-strand sequence immediately 3' of the stop codon of
S. pombe RNA triphosphatase Pct1 is a 303-amino acid polypeptide with a homodimeric quaternary structure [ 12 ] . The pct1 +gene contains a single intron within the open reading frame [ 12 ] . S. pombe RNA guanylyltransferase Pce1 is a 402-amino acid monomeric protein [ 20 ] ; there are no introns within the pce1 +gene.
The intron-less pce1 +gene was amplified from plasmid pl32-PCE1 [ 12 ] . The PCR products were digested with Xho I and Bam HI and then inserted into the S. pombe expression vector pREP41X ( LEU2 ars1 +) [ 19 ] . The inserts were sequenced to exclude the acquisition of unwanted mutations during the amplification and cloning steps.
We used a modified version of the long flanking homology PCR technique [ 17 ] to produce pct1Δ and pce1Δ gene disruption cassettes in which the open reading frames were replaced by the kanMX gene.
Genomic DNA was prepared from individual isolates and the integration of the pct1::kanMX or pce1::kanMX cassettes into the correct locus was tested by PCR using diagnostic primers.
Loading...