Words similar to mutagenesis

Example sentences for: mutagenesis

How can you use “mutagenesis” in a sentence? Here are some example sentences to help you improve your vocabulary:

This result suggested that mutagenesis of pcrG could be used to isolate PcrG mutants capable of blocking Yops secretion in Y. pestis . This genetic screen allowed the isolation of PcrG mutants that functioned in Y. pestis in a manner indistinguishable from LcrG (Fig.
This substantiates previous mutagenesis studies, which demonstrated that repulsive interactions and/or lack of productive electrostatic interactions between Glu39 and Glu192 of thrombin and PAI-1 are responsible for the slow reaction of thrombin with this serpin.
The inserted DNA acts as a tag, making cloning of mutated genes very straightforward, although the efficiency of the initial insertional mutagenesis is much lower than that of the chemical mutagenesis used in the 1992–1993 screens.
Mutagenesis
Plasmids pB32 and pB86, carrying H109A and H109D alleles of HNT2 , were constructed by site-directed mutagenesis [ 49 ] of plasmid pB05 using primers PB3 (5'ATAATGTGTGTAGCCAAGTGGGGT) and PB4 (5'TAATGTGTGTATCCAAGTGGGGTAC).