Words similar to haploid
Example sentences for: haploid
How can you use “haploid” in a sentence? Here are some example sentences to help you improve your vocabulary:
The same crosses were also used to determine if Tab +was recessive or dominant: for every tab mutant, haploid cdc15Δ tab [pMET3-cdcl5-2, URA3] and diploid cdc15Δ/cdc15Δ tab/+ [pMET3-cdc15-2, URA3 ] cells were pre-grown on YPD (1% yeast extract/2% peptone + 2% glucose) at 25°C for 2-3 days, spotted in 5-fold serial dilutions onto SD+5-FOA plates, and the number of 5-FOA resistant colonies from the diploid was divided by that from the haploid to obtain ratio P. The mutant was defined to be dominant if P= 0.1-1, semi-dominant if P= 0.01-0.
Preliminary characterization of the haploid cultures at temperatures ranging from 14°C to 37°C indicates that strains with the modified MDN1(HA) gene grow somewhat more slowly than those with the native MDN1(wt) gene, but appear otherwise normal.
With a haploid content of 430 million base pairs (Mbp), the rice genome is the smallest among cultivated cereals [ 5, 6] and only about three times larger than the smallest known genome among angiosperms, that of Arabidopsis thaliana (~130 Mbp).
An earlier report demonstrated that disruption of HNT2 was tolerated by haploid yeast strains without an effect on growth and that ApppN and AppppN accumulate 30 and 3-fold, respectively on account of the hnt2 deletion [ 13 ] . Because those data were obtained by random spore analysis, we considered it important to test whether elevated dinucleoside polyphosphate levels co-segregate with hnt2 disruption in all tetrads examined and whether any other commonly used genetic markers affect dinucleoside polyphosphate levels.
A 1570 bp DNA fragment containing an hnt2Δ::kanMX2 disruption cassette was generated as described [ 46 ] . Primers 4716 (5'GAAGCTCCATTGATCTATCTTGGGCTCAGAATGATCTTAAGCAAAACAAAGCTTCGTACGCTGCAG) and 4717 (5'CGTAAGTATGAATCTATTATTTATTGAACTATAGTGTTAAACCAGGGCCACTAGTGGATCTGA) were used to amplify the yeast expressible geneticin-resistance gene from pFA6a -kanMX2 [ 46 ] with 50 bp DNA ends corresponding to sequences upstream and downstream of HNT2 . The resulting fragment was transformed into haploid S. cerevisiae strain BY4727, and transformants were selected on YPD with 400 μg/ml geneticin.