Words similar to dazl
Example sentences for: dazl
How can you use “dazl” in a sentence? Here are some example sentences to help you improve your vocabulary:
Deletion of the DAZ genes is found in about 10% of infertile males with idiopathic azoospermia [ 2 ] , and disruption of Dazl1 causes infertility in both male and female mice [ 6 ] . Mutations in the DAZ family members of Drosophila [ 7 ] , C. elegans [ 8 ] , and Xenopus [ 9 ] also affect the fertility in either males, females, or both sexes.
The expression of both Dazl1 and Dazap1 persisted throughout testes development, in both the prenatal and postnatal periods.
Reverse transcription-polymerase chain reaction (RT-PCR) was carried out as preciously described using an annealing temperature of 54°C [ 27 ] . The primers were prdap35: agctcagggagtacttcaaga and prdap24 :ggagcttgattcttgctgtcc for Dazap1 which generated a product of 211 bp, and prdaz71: atcgaactggtgtgtcgaagg and prdaz72: ggaggctgcatgtaagtctca for Dazl1 which generated a product of 245 bp.
RNA-binding proteins have been found to participate in many cellular functions, including RNA transcription, pre-mRNA processing, mRNA transport, localization, translation and stability [ 20 ] . A role for the DAZ family in the regulation of mRNA translation is supported by lines of circumstantial evidence, including the association of DAZL with polyribosomes [ 12 ] . The absence of DAZAP1 from polyribosomes indicates that it is not directly involved in protein synthesis.
DAZ and DAZL are expressed in the nucleus and cytoplasm of primordial germ cells and spermatogonia, and in the cytoplasm of meiotic spermatocytes [ 6 10 ] . BOULE is expressed later, in the cytoplasm of pachytene spermatocytes [ 5 ] . Genetic and biochemical studies suggest a role for the DAZ family in the regulation of mRNA translation.