Example sentences for: dazl

How can you use “dazl” in a sentence? Here are some example sentences to help you improve your vocabulary:

  • Drosophila Boule mutants was defective in the translation of the meiosis-specific CDC25 homologue, Twine [ 11 ] , and DAZL was found to be associated with polyribosomes in mouse testes [ 12 ] . More recently, DAZL was shown both in vitro and in a yeast three-hybrid system to bind specifically to oligo(U) stretches interspersed by G or C residues, including a U-rich segment in the 5' UTR of mouse Cdc25C mRNA [ 13 ] .

  • Reverse transcription-polymerase chain reaction (RT-PCR) was carried out as preciously described using an annealing temperature of 54°C [ 27 ] . The primers were prdap35: agctcagggagtacttcaaga and prdap24 :ggagcttgattcttgctgtcc for Dazap1 which generated a product of 211 bp, and prdaz71: atcgaactggtgtgtcgaagg and prdaz72: ggaggctgcatgtaagtctca for Dazl1 which generated a product of 245 bp.

  • Deletion of the DAZ genes is found in about 10% of infertile males with idiopathic azoospermia [ 2 ] , and disruption of Dazl1 causes infertility in both male and female mice [ 6 ] . Mutations in the DAZ family members of Drosophila [ 7 ] , C. elegans [ 8 ] , and Xenopus [ 9 ] also affect the fertility in either males, females, or both sexes.

  • The DAZAP1 protein interacted with both DAZ and DAZL in vitro.

  • For example, DAZAP1 could be involved in the transport of the mRNAs of the target genes of DAZL.


How many words do you know? Try our free vocabulary size test!


Search

Search for example sentences

Loading Loading...
Quantcast