Words similar to dazl

Example sentences for: dazl

How can you use “dazl” in a sentence? Here are some example sentences to help you improve your vocabulary:

Our previous fractionation of mouse testis extracts showed that most DAZL were present in the post mitochondrial fraction, and some of them were associated with polyribosomes [ 12 ] . Similar analyses showed that a majority of DAZAP1 in adult mouse testes was also present in the cytoplasmic fraction (data not shown).
Comparing the phenotypes of Dazl1 and Dazap1 single and double knock-out mice may provide some clues to the significance of their interaction.
Nova-1 regulates the alternative splicing of the pre-mRNAs encoding neuronal inhibitory glycine receptor α2 (GlyR α2) [ 23 ] . The ability of Nova-1 to activate exon selection in neurons is antagonized by a second RNA-binding protein, brPTB (brain-enriched polypyrimidine tract-binding protein), which interacts with Nova-1 and inhibits its function [ 24 ] . DAZAP1 could function in a similar manner by binding to DAZL and inhibiting its function.
Reverse transcription-polymerase chain reaction (RT-PCR) was carried out as preciously described using an annealing temperature of 54°C [ 27 ] . The primers were prdap35: agctcagggagtacttcaaga and prdap24 :ggagcttgattcttgctgtcc for Dazap1 which generated a product of 211 bp, and prdaz71: atcgaactggtgtgtcgaagg and prdaz72: ggaggctgcatgtaagtctca for Dazl1 which generated a product of 245 bp.
The expression of DAZAP1 during germ cell development paralleled that of DAZL (Figure 5).