Words similar to dazl

Example sentences for: dazl

How can you use “dazl” in a sentence? Here are some example sentences to help you improve your vocabulary:

Dazl1 and Dazap1 transcripts were also present in the testes of W v/W vmutant mice which contained diminished number of germ cells [ 18 ] . However, only Dazap1 was expressed in a mouse germ cell line GCl-spg [ 19 ] and a Sertoli cell line MT4.
The DAZAP1 protein interacted with both DAZ and DAZL in vitro.
Reverse transcription-polymerase chain reaction (RT-PCR) was carried out as preciously described using an annealing temperature of 54°C [ 27 ] . The primers were prdap35: agctcagggagtacttcaaga and prdap24 :ggagcttgattcttgctgtcc for Dazap1 which generated a product of 211 bp, and prdaz71: atcgaactggtgtgtcgaagg and prdaz72: ggaggctgcatgtaagtctca for Dazl1 which generated a product of 245 bp.
Nova-1 regulates the alternative splicing of the pre-mRNAs encoding neuronal inhibitory glycine receptor α2 (GlyR α2) [ 23 ] . The ability of Nova-1 to activate exon selection in neurons is antagonized by a second RNA-binding protein, brPTB (brain-enriched polypyrimidine tract-binding protein), which interacts with Nova-1 and inhibits its function [ 24 ] . DAZAP1 could function in a similar manner by binding to DAZL and inhibiting its function.
Our previous fractionation of mouse testis extracts showed that most DAZL were present in the post mitochondrial fraction, and some of them were associated with polyribosomes [ 12 ] . Similar analyses showed that a majority of DAZAP1 in adult mouse testes was also present in the cytoplasmic fraction (data not shown).