Example sentences for: dazl

How can you use “dazl” in a sentence? Here are some example sentences to help you improve your vocabulary:

  • RNA-binding proteins have been found to participate in many cellular functions, including RNA transcription, pre-mRNA processing, mRNA transport, localization, translation and stability [ 20 ] . A role for the DAZ family in the regulation of mRNA translation is supported by lines of circumstantial evidence, including the association of DAZL with polyribosomes [ 12 ] . The absence of DAZAP1 from polyribosomes indicates that it is not directly involved in protein synthesis.

  • The expression of both Dazl1 and Dazap1 persisted throughout testes development, in both the prenatal and postnatal periods.

  • DAZ and DAZL are expressed in the nucleus and cytoplasm of primordial germ cells and spermatogonia, and in the cytoplasm of meiotic spermatocytes [ 6 10 ] . BOULE is expressed later, in the cytoplasm of pachytene spermatocytes [ 5 ] . Genetic and biochemical studies suggest a role for the DAZ family in the regulation of mRNA translation.

  • Reverse transcription-polymerase chain reaction (RT-PCR) was carried out as preciously described using an annealing temperature of 54°C [ 27 ] . The primers were prdap35: agctcagggagtacttcaaga and prdap24 :ggagcttgattcttgctgtcc for Dazap1 which generated a product of 211 bp, and prdaz71: atcgaactggtgtgtcgaagg and prdaz72: ggaggctgcatgtaagtctca for Dazl1 which generated a product of 245 bp.

  • The expression of DAZAP1 during germ cell development paralleled that of DAZL (Figure 5).


How many words do you know? Try our free vocabulary size test!


Search

Search for example sentences

Loading Loading...
Quantcast