Words similar to dazap

Example sentences for: dazap

How can you use “dazap” in a sentence? Here are some example sentences to help you improve your vocabulary:

The Vg1 RNA encodes a member of the transforming growth factor-β family that is required for generating dorsal mesoderm at the blastula stage of Xenopus embryogenesis [ 25 ] . Sequence conservation between the RBDs of DAZAP1 and Prrp suggests that these proteins may bind to similar RNA sequences.
RT-PCR analyses showed that Dazap1 mRNA was already present in fetal testes at embryonic day 15, similar to Dazl1 mRNA (Figure 3).
Reverse transcription-polymerase chain reaction (RT-PCR) was carried out as preciously described using an annealing temperature of 54°C [ 27 ] . The primers were prdap35: agctcagggagtacttcaaga and prdap24 :ggagcttgattcttgctgtcc for Dazap1 which generated a product of 211 bp, and prdaz71: atcgaactggtgtgtcgaagg and prdaz72: ggaggctgcatgtaagtctca for Dazl1 which generated a product of 245 bp.
The 5' RACE clone with the longest 5' UTR region and the cDNA clone P21 were ligated together through a unique Pml I site at # 722 to generate a cDNA clone (Dazap1-C) with a near full-length insert.
PCR primers (prdap25: cacctccaggatgtgttagc and prdazp26:gtcaccaagggtgtctgaag) were designed from intronic sequences flanking Dazap1 exon 8. These primers amplified a 271 bp fragment from mouse but not hamster genomic DNA.