Words similar to dazap

Example sentences for: dazap

How can you use “dazap” in a sentence? Here are some example sentences to help you improve your vocabulary:

Several overlapping lambda clones containing mouse Dazap1 genomic sequences were isolated.
PCR primers (prdap25: cacctccaggatgtgttagc and prdazp26:gtcaccaagggtgtctgaag) were designed from intronic sequences flanking Dazap1 exon 8. These primers amplified a 271 bp fragment from mouse but not hamster genomic DNA.
Our previous fractionation of mouse testis extracts showed that most DAZL were present in the post mitochondrial fraction, and some of them were associated with polyribosomes [ 12 ] . Similar analyses showed that a majority of DAZAP1 in adult mouse testes was also present in the cytoplasmic fraction (data not shown).
This pattern of expression is similar to that of the human DAZAP1 (14).
Chromosomal mapping of Dazap1