Words similar to dazap

Example sentences for: dazap

How can you use “dazap” in a sentence? Here are some example sentences to help you improve your vocabulary:

The expression of DAZAP1 during germ cell development paralleled that of DAZL (Figure 5).
Reverse transcription-polymerase chain reaction (RT-PCR) was carried out as preciously described using an annealing temperature of 54°C [ 27 ] . The primers were prdap35: agctcagggagtacttcaaga and prdap24 :ggagcttgattcttgctgtcc for Dazap1 which generated a product of 211 bp, and prdaz71: atcgaactggtgtgtcgaagg and prdaz72: ggaggctgcatgtaagtctca for Dazl1 which generated a product of 245 bp.
About 50 μg of tissue extracts were separated on 10% SDS-polyacrylamide gels and blotted with either the anti-DAZAP1-C antibody (at a 1/2,000 dilution) or the anti-DAZAP1-P antibody (at a 1/5,000 dilution).
RNA-binding proteins have been found to participate in many cellular functions, including RNA transcription, pre-mRNA processing, mRNA transport, localization, translation and stability [ 20 ] . A role for the DAZ family in the regulation of mRNA translation is supported by lines of circumstantial evidence, including the association of DAZL with polyribosomes [ 12 ] . The absence of DAZAP1 from polyribosomes indicates that it is not directly involved in protein synthesis.
The genomic structure of Dazap1, delineated here, should facilitate the generating of Dazap1 null mutation.