Words similar to dazap

Example sentences for: dazap

How can you use “dazap” in a sentence? Here are some example sentences to help you improve your vocabulary:

Genomic structure of Dazap1and chromosomal mapping
To study the expression of the DAZAP1 protein, two antibodies against mouse DAZAP1 were generated.
Our previous fractionation of mouse testis extracts showed that most DAZL were present in the post mitochondrial fraction, and some of them were associated with polyribosomes [ 12 ] . Similar analyses showed that a majority of DAZAP1 in adult mouse testes was also present in the cytoplasmic fraction (data not shown).
Generation of anti-DAZAP1 antibodies
PCR primers (prdap25: cacctccaggatgtgttagc and prdazp26:gtcaccaagggtgtctgaag) were designed from intronic sequences flanking Dazap1 exon 8. These primers amplified a 271 bp fragment from mouse but not hamster genomic DNA.