Example sentences for: dazap

How can you use “dazap” in a sentence? Here are some example sentences to help you improve your vocabulary:

  • Several overlapping lambda clones containing mouse Dazap1 genomic sequences were isolated.

  • PCR primers (prdap25: cacctccaggatgtgttagc and prdazp26:gtcaccaagggtgtctgaag) were designed from intronic sequences flanking Dazap1 exon 8. These primers amplified a 271 bp fragment from mouse but not hamster genomic DNA.

  • Our previous fractionation of mouse testis extracts showed that most DAZL were present in the post mitochondrial fraction, and some of them were associated with polyribosomes [ 12 ] . Similar analyses showed that a majority of DAZAP1 in adult mouse testes was also present in the cytoplasmic fraction (data not shown).

  • This pattern of expression is similar to that of the human DAZAP1 (14).

  • Chromosomal mapping of Dazap1


How many words do you know? Try our free vocabulary size test!


Search

Search for example sentences

Loading Loading...
Quantcast