Words similar to cgi
- cgcaagcttactcaaggcacggaatc-
- cgcagatctagaaaactttttaga-
- cgg
- cggaacttcaccttttctggc-
- cggacgtccgttcacgtgtttgttatgaatttatttatgatgagtcattat
- cgggccccgggacagacg-
- cgggggctgagcaccagaggctgct-
- cggtgtgaacggatttggccgtat-
- cggttctttttgtcaagac
- cgh
- cgi
- cgi-access
- cgi-bin
- cgiand
- cgiusing
- cgives
- cgl
- cgma
- cgma-predicted
- cgmp
- cgn
Example sentences for: cgi
How can you use “cgi” in a sentence? Here are some example sentences to help you improve your vocabulary:
Primers used for amplification of BMP-5 cDNA were designed to unique sequences of rat BMP-5 using the Primer3 program http://www-genome.wi.mit.edu/cgi-bin/primer/primer3_www.cgi.
157461 [http://www.ncbi.nlm.nih.gov/UniGene/clust.cgi?ORG=Hs&CID=157461; MyoD (Hs.
162646 [http://www.ncbi.nlm.nih.gov/UniGene/clust.cgi?ORG=Hs&CID=162646]).
A user interface is available at http://gene.cpmc.columbia.edu/cgi-bin/gene.cgi.
The CGI script and data that are used to produce the website are available for downloadand from [ 20].
Loading...