Words similar to cgi
- cgcaagcttactcaaggcacggaatc-
- cgcagatctagaaaactttttaga-
- cgg
- cggaacttcaccttttctggc-
- cggacgtccgttcacgtgtttgttatgaatttatttatgatgagtcattat
- cgggccccgggacagacg-
- cgggggctgagcaccagaggctgct-
- cggtgtgaacggatttggccgtat-
- cggttctttttgtcaagac
- cgh
- cgi
- cgi-access
- cgi-bin
- cgiand
- cgiusing
- cgives
- cgl
- cgma
- cgma-predicted
- cgmp
- cgn
Example sentences for: cgi
How can you use “cgi” in a sentence? Here are some example sentences to help you improve your vocabulary:
A user interface is available at http://gene.cpmc.columbia.edu/cgi-bin/gene.cgi.
520119 [http://www.ncbi.nlm.nih.gov/UniGene/clust.cgi?ORG=Hs&CID=520119; myogenin (Hs.
513941 [http://www.ncbi.nlm.nih.gov/UniGene/clust.cgi?ORG=Hs&CID=513941; Nanog (Hs.
We have also compared our RP results with those for SAGE carried out with pooled human adult brain (tissue supplied by Gregory J. Riggins: http://www.ncbi.nlm.nih.gov/sage/sagerec.cgi?rec=161).
519385 [http://www.ncbi.nlm.nih.gov/UniGene/clust.cgi?ORG=Hs&CID=519385; hepatocyte growth factor (Hs.
Loading...