Words similar to cgi
- cgcaagcttactcaaggcacggaatc-
- cgcagatctagaaaactttttaga-
- cgg
- cggaacttcaccttttctggc-
- cggacgtccgttcacgtgtttgttatgaatttatttatgatgagtcattat
- cgggccccgggacagacg-
- cgggggctgagcaccagaggctgct-
- cggtgtgaacggatttggccgtat-
- cggttctttttgtcaagac
- cgh
- cgi
- cgi-access
- cgi-bin
- cgiand
- cgiusing
- cgives
- cgl
- cgma
- cgma-predicted
- cgmp
- cgn
Example sentences for: cgi
How can you use “cgi” in a sentence? Here are some example sentences to help you improve your vocabulary:
The UniSTS database (http://www.ncbi.nlm.nih.gov/genome/ sts/epcr.cgi) located D1S425 on contig NT_004656.
A detailed description of the HRR method can be found in [ 19 ] which can be downloaded free of charge from the website http://ajpheart.physiology.org/cgi/content/abstract/277/5/H1762.
In the initial step, the entire peptide sequence and consensus motifs (if found) are entered into an Advanced BLAST search http://www.ncbi.nlm.nih.gov/blast/blast.cgi?Jform=1: using the following parameters:
519385 [http://www.ncbi.nlm.nih.gov/UniGene/clust.cgi?ORG=Hs&CID=519385; hepatocyte growth factor (Hs.
The CGI script and data used to produce the website
Loading...