Words similar to cgi
- cgcaagcttactcaaggcacggaatc-
- cgcagatctagaaaactttttaga-
- cgg
- cggaacttcaccttttctggc-
- cggacgtccgttcacgtgtttgttatgaatttatttatgatgagtcattat
- cgggccccgggacagacg-
- cgggggctgagcaccagaggctgct-
- cggtgtgaacggatttggccgtat-
- cggttctttttgtcaagac
- cgh
- cgi
- cgi-access
- cgi-bin
- cgiand
- cgiusing
- cgives
- cgl
- cgma
- cgma-predicted
- cgmp
- cgn
Example sentences for: cgi
How can you use “cgi” in a sentence? Here are some example sentences to help you improve your vocabulary:
396530 [http://www.ncbi.nlm.nih.gov/UniGene/clust.cgi?ORG=Hs&CID=396530; mesenchymal stem cell protein (DSC54, Hs.
A detailed description of the HRR method can be found in [ 19 ] which can be downloaded free of charge from the website http://ajpheart.physiology.org/cgi/content/abstract/277/5/H1762.
518726 [http://www.ncbi.nlm.nih.gov/UniGene/clust.cgi?ORG=Hs&CID=518726; bone-specific alkaline phosphatase (Hs.
The UniSTS database (http://www.ncbi.nlm.nih.gov/genome/ sts/epcr.cgi) located D1S425 on contig NT_004656.
With our data set of 49 (two diatom-specific introns were excluded from this analysis) different spliceosomal intron sites in the SSU and LSU rRNAs of Euascomycetes (alignment available at http://www.rna.icmb.utexas.edu/ANALYSIS/FUNGINT/(for registration details please see http://www.rnq.icmb.utexas.edu/cgi-access/access/locked.cgi), we first tested for the presence of a proto-splice site flanking the introns [ 12 ] . In this chi-square analysis, the null hypothesis specified that nucleotide usage in 50 nt of exon sequence upstream and downstream of the different intron insertion sites was random and dependent on the nucleotide composition of Euascomycetes SSU and LSU rRNA sequences in general.