Words similar to cgi
- cgcaagcttactcaaggcacggaatc-
- cgcagatctagaaaactttttaga-
- cgg
- cggaacttcaccttttctggc-
- cggacgtccgttcacgtgtttgttatgaatttatttatgatgagtcattat
- cgggccccgggacagacg-
- cgggggctgagcaccagaggctgct-
- cggtgtgaacggatttggccgtat-
- cggttctttttgtcaagac
- cgh
- cgi
- cgi-access
- cgi-bin
- cgiand
- cgiusing
- cgives
- cgl
- cgma
- cgma-predicted
- cgmp
- cgn
Example sentences for: cgi
How can you use “cgi” in a sentence? Here are some example sentences to help you improve your vocabulary:
396530 [http://www.ncbi.nlm.nih.gov/UniGene/clust.cgi?ORG=Hs&CID=396530; mesenchymal stem cell protein (DSC54, Hs.
In the initial step, the entire peptide sequence and consensus motifs (if found) are entered into an Advanced BLAST search http://www.ncbi.nlm.nih.gov/blast/blast.cgi?Jform=1: using the following parameters:
513941 [http://www.ncbi.nlm.nih.gov/UniGene/clust.cgi?ORG=Hs&CID=513941; Nanog (Hs.
520119 [http://www.ncbi.nlm.nih.gov/UniGene/clust.cgi?ORG=Hs&CID=520119; myogenin (Hs.
162646 [http://www.ncbi.nlm.nih.gov/UniGene/clust.cgi?ORG=Hs&CID=162646]).
Loading...