Words similar to cgg
- cfu
- cg
- cgc
- cgcaagcttactcaaggcacggaatc-
- cgcagatctagaaaactttttaga-
- cgctaatgaaaggaagaggaaaaagatgccagcctcc
- cgctccagagtgctggca
- cgctgtgtttgagccatc-
- cgd
- cge
- cgg
- cggaacttcaccttttctggc-
- cggaattcaaccccgtcctgatgctgagaaag-
- cggaattcgaagaggaacagaagtggaaatgg-
- cggaattctttgtggccatttatgtttttgac-
- cggacgtccgttcacgtgtttgttatgaatttatttatgatgagtcattat
- cggagaacctgcgtgcaatccatc-
- cggagaagaagaggagacca-
- cgi
- cgi-access
- cgi-bin
- cgtaagtatgaatctattatttattgaactatagtgttaaaccagggccactagtggatctga
- cgtacgtcccccactcct
- cgtatagttggtgtgcggcat-
- cgtcaatact
- cgttggcatgctgaccagcct-
- ch
- ch-
- ch-oh
- cha
- chad
Example sentences for: cgg
How can you use “cgg” in a sentence? Here are some example sentences to help you improve your vocabulary:
9: CTG ATG TTC CTC GGg CAG TTC CGg TTg CAG (mismatches are in lower case)
For rabbit EP2: 5'-TCC TCC CGA AAA GAA AAG TGG-3' for sense and 5'-TGT TTA CCC CGT TTT ATC AGG-3' for antisense; for rabbit GAPDH: 5'-CGG AGC CAA AAG GGT CAT CAT-3' for sense and 5'-TTT CTC CAG GCG GCA GGT CAG-3' for antisense.
66: CTA G AG GGG AAT TGT TAT CCG CTC ACA ATT CCC CTA TAG TGN NNN GTA TTA ATT TCG CGG GAT CGA (XbaI site in bold; N indicates a random sequence region)
Here we plot only the graph for two arginine codons, CGA and CGG (Figure 1a), and for two amino acids, arginine and threonine (Figure 1b), to illustrate that some codons and amino acids, such as CGC and arginine, show a clear relationship with genome GC content; others, such as CGA and threonine, show no relationship whatsoever.
For EBV DNA detection two primer pairs EBER 3 (5' gca acg gct gct ctg ttt ga), EBER 5 (5' gtg gtc cgc atg ttt tga tc) and TC60 (5' cca gag gta agt gga ctt), TC61 (5' gac cgg tgc ctt ctt agg) were used.
Loading...