Words similar to cgg
- cfu
- cg
- cgc
- cgcaagcttactcaaggcacggaatc-
- cgcagatctagaaaactttttaga-
- cgctaatgaaaggaagaggaaaaagatgccagcctcc
- cgctccagagtgctggca
- cgctgtgtttgagccatc-
- cgd
- cge
- cgg
- cggaacttcaccttttctggc-
- cggaattcaaccccgtcctgatgctgagaaag-
- cggaattcgaagaggaacagaagtggaaatgg-
- cggaattctttgtggccatttatgtttttgac-
- cggacgtccgttcacgtgtttgttatgaatttatttatgatgagtcattat
- cggagaacctgcgtgcaatccatc-
- cggagaagaagaggagacca-
- cgi
- cgi-access
- cgi-bin
- cgtaagtatgaatctattatttattgaactatagtgttaaaccagggccactagtggatctga
- cgtacgtcccccactcct
- cgtatagttggtgtgcggcat-
- cgtcaatact
- cgttggcatgctgaccagcct-
- ch
- ch-
- ch-oh
- cha
- chad
Example sentences for: cgg
How can you use “cgg” in a sentence? Here are some example sentences to help you improve your vocabulary:
Here we plot only the graph for two arginine codons, CGA and CGG (Figure 1a), and for two amino acids, arginine and threonine (Figure 1b), to illustrate that some codons and amino acids, such as CGC and arginine, show a clear relationship with genome GC content; others, such as CGA and threonine, show no relationship whatsoever.
66: CTA G AG GGG AAT TGT TAT CCG CTC ACA ATT CCC CTA TAG TGN NNN GTA TTA ATT TCG CGG GAT CGA (XbaI site in bold; N indicates a random sequence region)
The HCMV DNA was detected using HCMV1 (5' cct agt gtg gat gac cta cgg gcc a) and HCMV2 (5' cag aca cag tgt cct ccc gct cct c) primers producing 249 bp long amplicon and the DNA of HHV6 was amplified with specific primer pair HP0 (5' ccg caa tcg aat cca cct agc gg) and HP4 (5' gtg aga acg gat tcg aac agt gct g) yielding 440 bp product [ 23 24 ] . All amplifications were carried out with 20 pmol of each primer in 2 mM solution of MgCl 2 , 2 U of Tag Special DNA polymerase (Biovendor, Czech Republic), 0.3 mM of each dNTPs, 10× reaction buffer and 1 μg of isolated DNA according to the following conditions: 96°C for 4 min, (94°C for 10 sec, 58°C for 10 sec, 72°C for 20 sec) 36 times, and final extension at 72°C for 2 min.
The RACE conditions were as follows: 50 μl reactions containing 1X KlenTaq buffer and Advantage KlenTaq Polymerase Mix (Clontech, Palo Alto, CA), 0.2 mM deoxyribonucleotides, 0.2 μM NPM3 GSP1 (5'-CGG TGA GGC AGA GCA TGG TTA GTG C-3'), and 0.2 μM API primer (Clontech, Palo Alto, CA).
9: CTG ATG TTC CTC GGg CAG TTC CGg TTg CAG (mismatches are in lower case)