Words similar to cgc
- cfm
- cfsan
- cftr
- cfu
- cg
- cgap-gai
- cgatgatctgactaccaccc
- cgatggaattgggtggaaag-
- cgatt-
- cgauaauauaacugcaagatt
- cgc
- cgcaagcttactcaaggcacggaatc-
- cgcagatctagaaaactttttaga-
- cgcataaatggttgggagtt-
- cgccc
- cgccggtagctcgcgagaacgcggcgctcg-
- cgcgaa
- cgcggatccgtttacacatagttattgatagaatct-
- cgg
- cggaacttcaccttttctggc-
- cggacgtccgttcacgtgtttgttatgaatttatttatgatgagtcattat
Example sentences for: cgc
How can you use “cgc” in a sentence? Here are some example sentences to help you improve your vocabulary:
For EBV DNA detection two primer pairs EBER 3 (5' gca acg gct gct ctg ttt ga), EBER 5 (5' gtg gtc cgc atg ttt tga tc) and TC60 (5' cca gag gta agt gga ctt), TC61 (5' gac cgg tgc ctt ctt agg) were used.
Binding reactions were carried out at room temperature for 30 min in a total volume of 15 μl and contained 2-5 μg of nuclear extracts, 5 μl of 5X gel shift binding buffer (20% glycerol, 5 mM MgCl 2 , 2.5 mM EDTA, 2.5 mM DTT, 250 mM NaCl, 50 mM Tris-HCl, pH 7.5), 2 μg poly (dI-dC) and 3 × 10 4cpm/μl of [ 32P] labeled CREB (5'-AGA GAT TGC CTG ACG TCA GAG AGC TAG-3'), NF-κB (5'-AGT TGA GGG GAC TTT CCC AGG C-3') (Promega Gel Shift Assay Systems, Madison, WI, USA) or CCAAT/enhancer binding protein (C/EBP) (5'-TGC AGA TTG CGC AAT CTG CA-3') (Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA) oligonucleotides.
The primer pair for β-actin was GTC CTC TCC CAA GTC CAC ACA (forward) and CTG GTC TCA AGT CAG TGT ACA GGT AA (reverse), that of IL-8 was CTG CGC CAA CAC AGA AAT TA (forward) and ATT GCA TCT GGC AAC CCT AC (reverse), that of MCP-1 was GCC TCC AGC ATG AAA GTC TC (forward) and TAA AAC AGG GTG TCT GGG GA (reverse), that of IP-10 was CCA CGT GTT GAG ATC ATT GC (forward) and TGG AAG ATG GGA AAG GTG AG (reverse), that of RANTES was CGC TGT CAT CCT CAT TGC TA (forward) and GCT GTC TCG AAC TCC TGA CC (reverse), that of MIP-1α was TGC AAC CAG TTC TCT GCA TC (forward) and ACA GGG GAA CTC TCA GAG CA (reverse), and that of MIP-1β was CTG GGT CCA GGA GTA CGT GT (forward) and ACA GTG GAC CAT CCC CAT AG (reverse).
Primer sequences were: IL-7 [ 65 ] : IL-7 (5') 5'ACT ACA CCC ACC TCC CGC A3'; IL-7 (3') 5'TCT CAG TAG TCT CTT TAG G3'; SCF [ 65 ] : SCF (5') 5'TCT TCA ACT GCT CCT ATT T3'; SCF (3') 5'ACT GCT ACT GCT GTC ATT C3'; TGFβ1 [ 66 ] : TGFβ1(5') 5'GCG GAC TAC TAT GCT AAA GAG G3'; TGFβ1(3') 5'GTT GTG TTG GTT GTA GAG GGC A3'; β-actin [ 67 ] : β-actin (5') 5'GGG TCA GAA GGA CTC CTA TG3'; β-actin (3') 5'GTA ACA ATG CCA TGT TCA AT3'.
Here we plot only the graph for two arginine codons, CGA and CGG (Figure 1a), and for two amino acids, arginine and threonine (Figure 1b), to illustrate that some codons and amino acids, such as CGC and arginine, show a clear relationship with genome GC content; others, such as CGA and threonine, show no relationship whatsoever.
Loading...