Words similar to cgtaagtatgaatctattatttattgaactatagtgttaaaccagggccactagtggatctga
Example sentences for: cgtaagtatgaatctattatttattgaactatagtgttaaaccagggccactagtggatctga
How can you use “cgtaagtatgaatctattatttattgaactatagtgttaaaccagggccactagtggatctga” in a sentence? Here are some example sentences to help you improve your vocabulary:
A 1570 bp DNA fragment containing an hnt2Δ::kanMX2 disruption cassette was generated as described [ 46 ] . Primers 4716 (5'GAAGCTCCATTGATCTATCTTGGGCTCAGAATGATCTTAAGCAAAACAAAGCTTCGTACGCTGCAG) and 4717 (5'CGTAAGTATGAATCTATTATTTATTGAACTATAGTGTTAAACCAGGGCCACTAGTGGATCTGA) were used to amplify the yeast expressible geneticin-resistance gene from pFA6a -kanMX2 [ 46 ] with 50 bp DNA ends corresponding to sequences upstream and downstream of HNT2 . The resulting fragment was transformed into haploid S. cerevisiae strain BY4727, and transformants were selected on YPD with 400 μg/ml geneticin.
Loading...