Words similar to ccc
- cbsnews
- cbw
- cby
- cbyj
- cc
- cca
- ccaf
- ccaf-induced
- ccaf-treated
- ccagagcagggt
- ccagctgatccttcaggaactgc
- ccal
- ccamlr
- ccatagtctggttaacatca
- ccatccacagtcttctg
- ccc
- cccaaccaagctctcttgag-
- cccaacttgatgtatgaagg-
- cccaagcttcttcgtcagcctcccttccac
- cccaagctttctcccgggtctgcacgaccgcctct
- cccaagt
- ccd
- ccedil
- ccg
- ccggctcgagtcacttggtgtcggtggcgcatg-
- ccggcttgtcctcggacacggtgcagcccatggtg-
- cchange
- cd
- cdna
- cdna-
Example sentences for: ccc
How can you use “ccc” in a sentence? Here are some example sentences to help you improve your vocabulary:
80: C GCT ATC cTT GTT GGT GTT gAT GGT AGG NNN TAA NNN GAA CTG cCC GAG GAA CAT CAG NNN CAA GCG CGT CTG AAT AGG C (regions 2241-2244, 2266-2268, 2272-2274 are randomized, silent mutations are in lower case)
Transfer by CCC to Federal Crop Insurance Corporation (594)
This payment does not arise from an exchange transaction, because FCIC does not sacrifice anything of value to CCC, and CCC does not receive anything of value from FCIC.
Here, CCC did not make such a finding but published the proposed rule on October 11, 1996, in accordance with the Administrative Procedure Act.
Following extraction, we first amplified the picornavirus RNA using primers OL26 (5'-GCA CTT CTG TTT CCC C-3') [ 33 ] and OL27 (5'-CGG ACA CCC AAA GTA G-3') [ 33 ] using the Invitrogen SuperScript One-Step RT-PCR with PLATINUM Taq Kit (Invitrogen Corp., Carlsbad, California).
Loading...