Words similar to ccc
- cbsnews
- cbw
- cby
- cbyj
- cc
- cca
- ccaf
- ccaf-induced
- ccaf-treated
- ccagagcagggt
- ccagctgatccttcaggaactgc
- ccal
- ccamlr
- ccatagtctggttaacatca
- ccatccacagtcttctg
- ccc
- cccaaccaagctctcttgag-
- cccaacttgatgtatgaagg-
- cccaagcttcttcgtcagcctcccttccac
- cccaagctttctcccgggtctgcacgaccgcctct
- cccaagt
- ccd
- ccedil
- ccg
- ccggctcgagtcacttggtgtcggtggcgcatg-
- ccggcttgtcctcggacacggtgcagcccatggtg-
- cchange
- cd
- cdna
- cdna-
Example sentences for: ccc
How can you use “ccc” in a sentence? Here are some example sentences to help you improve your vocabulary:
The Southern Poverty Law Center says the CCC is "the reincarnation of the racist white Citizens Councils" that battled integration in the 1950s.
Enclosed is our assessment of the CCC's compliance with the procedural steps required by section 801(a)(1)(B)(i) through (iv) of title 5 with respect to the rule.
80: C GCT ATC cTT GTT GGT GTT gAT GGT AGG NNN TAA NNN GAA CTG cCC GAG GAA CAT CAG NNN CAA GCG CGT CTG AAT AGG C (regions 2241-2244, 2266-2268, 2272-2274 are randomized, silent mutations are in lower case)
The HCMV DNA was detected using HCMV1 (5' cct agt gtg gat gac cta cgg gcc a) and HCMV2 (5' cag aca cag tgt cct ccc gct cct c) primers producing 249 bp long amplicon and the DNA of HHV6 was amplified with specific primer pair HP0 (5' ccg caa tcg aat cca cct agc gg) and HP4 (5' gtg aga acg gat tcg aac agt gct g) yielding 440 bp product [ 23 24 ] . All amplifications were carried out with 20 pmol of each primer in 2 mM solution of MgCl 2 , 2 U of Tag Special DNA polymerase (Biovendor, Czech Republic), 0.3 mM of each dNTPs, 10× reaction buffer and 1 μg of isolated DNA according to the following conditions: 96°C for 4 min, (94°C for 10 sec, 58°C for 10 sec, 72°C for 20 sec) 36 times, and final extension at 72°C for 2 min.
A man of durable fascination to the CCC, the first article: "Liar?