Words similar to arsd

Example sentences for: arsd

How can you use “arsd” in a sentence? Here are some example sentences to help you improve your vocabulary:

ARSd: tgagtcattattggataaagaatcgtaaaaactgctttaaacgataaaa
The ars operon consists of a group of genes coding for a transmembrane pump and an arsenate reductase ( arsC ). The operon includes a regulatory gene ( arsR ) and a gene coding for an arsenite-specific pump ( arsB ) as well as arsC [ 13 ] . Arsenite is pumped directly out of the cell by the arsB protein; however arsenate must first be reduced to arsenite by the cytoplasmic arsenate reductase coded from arsC . Some bacteria also possess other ars genes: arsA produces an arsenite-stimulated ATPase [ 14 ] that results in more efficient arsenite extrusion; arsD encodes for a regulatory protein that controls the upper level of ars expression [ 15 ] ; arsH has been identified but has an uncertain function [ 16 ] . The ars operon was initially recognized in plamids of Staphylococcus aureus and S. xylosus [ 17 18 ] but has subsequently been found in other microorganisms (e.g.
This was further confirmed by making mutations in the ARSd fragment.
Introduction of a single ACS like element (9/11 match) in p21N (ARSc and ARSd) showed a strong band shift (Fig.
Surprisingly, p35 showed strong binding activity in the presence of the oligo ARSb (64% AT rich), ARSc (66% AT rich) and ARSd (74% AT rich) respectively (Figure 7D).