Words similar to arsd

Example sentences for: arsd

How can you use “arsd” in a sentence? Here are some example sentences to help you improve your vocabulary:

Introduction of a single ACS like element (9/11 match) in p21N (ARSc and ARSd) showed a strong band shift (Fig.
ARSd: tgagtcattattggataaagaatcgtaaaaactgctttaaacgataaaa
The ars operon consists of a group of genes coding for a transmembrane pump and an arsenate reductase ( arsC ). The operon includes a regulatory gene ( arsR ) and a gene coding for an arsenite-specific pump ( arsB ) as well as arsC [ 13 ] . Arsenite is pumped directly out of the cell by the arsB protein; however arsenate must first be reduced to arsenite by the cytoplasmic arsenate reductase coded from arsC . Some bacteria also possess other ars genes: arsA produces an arsenite-stimulated ATPase [ 14 ] that results in more efficient arsenite extrusion; arsD encodes for a regulatory protein that controls the upper level of ars expression [ 15 ] ; arsH has been identified but has an uncertain function [ 16 ] . The ars operon was initially recognized in plamids of Staphylococcus aureus and S. xylosus [ 17 18 ] but has subsequently been found in other microorganisms (e.g.
This was further confirmed by making mutations in the ARSd fragment.
Surprisingly, p35 showed strong binding activity in the presence of the oligo ARSb (64% AT rich), ARSc (66% AT rich) and ARSd (74% AT rich) respectively (Figure 7D).