Words similar to arsb
Example sentences for: arsb
How can you use “arsb” in a sentence? Here are some example sentences to help you improve your vocabulary:
A simple phylogenetic tree showing the relationships between the arsenate reductases of seven Bacteria (those that had been confirmed to possess the gene at that time) was presented as part of a study that identified the arsenic resistance genes of Thiobacillus ferrooxidans (now Acidithiobacillus ferroxidans ) [ 27 ] . Saltikov and Olson [ 28 ] used probes/primers based on the E. coli ars operon to detect ars genes in natural environments, and presented a phylogenetic analysis of these genes, however their analysis was largely confined to enteric bacteria (those that were similar enough to E. coli to be detected) and they emphasized the arsB gene rather than arsC . As part of a review of microbial arsenic transformations, we recently determined a preliminary arsC phylogeny based on 19 sequences [ 29 ] . These three studies reported phylogenies that suggested a common origin for the ars genes examined [ 27 28 29 ] . An alternative view suggested by Mukhopadhyay et al.
ARSb, c and d contain at least one ACS like element (Fig.
The ars operon consists of a group of genes coding for a transmembrane pump and an arsenate reductase ( arsC ). The operon includes a regulatory gene ( arsR ) and a gene coding for an arsenite-specific pump ( arsB ) as well as arsC [ 13 ] . Arsenite is pumped directly out of the cell by the arsB protein; however arsenate must first be reduced to arsenite by the cytoplasmic arsenate reductase coded from arsC . Some bacteria also possess other ars genes: arsA produces an arsenite-stimulated ATPase [ 14 ] that results in more efficient arsenite extrusion; arsD encodes for a regulatory protein that controls the upper level of ars expression [ 15 ] ; arsH has been identified but has an uncertain function [ 16 ] . The ars operon was initially recognized in plamids of Staphylococcus aureus and S. xylosus [ 17 18 ] but has subsequently been found in other microorganisms (e.g.
Surprisingly, p35 showed strong binding activity in the presence of the oligo ARSb (64% AT rich), ARSc (66% AT rich) and ARSd (74% AT rich) respectively (Figure 7D).
ARSb: tctaaaatacaaatctagaaaatacgaacgaaaagttttccggacgtccgt
Loading...