Words similar to arsa

Example sentences for: arsa

How can you use “arsa” in a sentence? Here are some example sentences to help you improve your vocabulary:

Complementary oligos corresponding to ARSa, b, c, d and dmut (Fig.
ARSa: ttagtttttcggtttactaaatcgtaatagaaatgtagaacaataaaatgt
The ars operon consists of a group of genes coding for a transmembrane pump and an arsenate reductase ( arsC ). The operon includes a regulatory gene ( arsR ) and a gene coding for an arsenite-specific pump ( arsB ) as well as arsC [ 13 ] . Arsenite is pumped directly out of the cell by the arsB protein; however arsenate must first be reduced to arsenite by the cytoplasmic arsenate reductase coded from arsC . Some bacteria also possess other ars genes: arsA produces an arsenite-stimulated ATPase [ 14 ] that results in more efficient arsenite extrusion; arsD encodes for a regulatory protein that controls the upper level of ars expression [ 15 ] ; arsH has been identified but has an uncertain function [ 16 ] . The ars operon was initially recognized in plamids of Staphylococcus aureus and S. xylosus [ 17 18 ] but has subsequently been found in other microorganisms (e.g.
p35 did not bind to p21N + ARSa which contains ARSa oligo (78% AT rich) with no ACS like element.
The sequences of ARSa, b, c and d are followed: