Words similar to accurate
- acctcccaaactatagattgggtg
- acctgcactc
- acctran
- accttattttaaaaataaagttaa-
- accttggaagaaccaaatc
- accumulated
- accumulating
- accumulation
- accumulations
- accupressure
- accuracies
- accuracy
- accuracy-the
- accurate
- accurate--
- accurate--than
- accurate--to
- accurately
- accuratelymodel
- accurist
- accursed
- accusations
- accused
- accytnarggt
- acd
- ace
- ace-i
- ace-inhibitor
Example sentences for: accurate
How can you use “accurate” in a sentence? Here are some example sentences to help you improve your vocabulary:
Having myself dealt with consultant linguists and specialists in other fields who contribute something to the preparation of accurate structure and definitions to a dictionary, I think I can safely say that such people are only indirectly responsible for the quality of a dictionary, and the major responsibility for a book of such complexity rests with the editors.
There is no doubt that the book is very well presented, well written, and well organized; moreover, it offers good, sound, accurate information about the lexicon of English.
Each of these genomes contains over 10,000 genes, and as scientists attempt to study these genes more closely, the need for accurate gene models becomes increasingly apparent.
In 1990, the institute closed its doors to a French sociologist, Bruno Latour, who made declarations such as the following: "To call a claim 'absurd' or knowledge 'accurate' has no more meaning than to call a smuggler trail 'illogical' and a freeway 'logical.
It is impossible to get an accurate figure for the total market, which has been estimated at two million sales a year.
Loading...