Words similar to accurate
- acctcccaaactatagattgggtg
- acctgcactc
- acctran
- accttattttaaaaataaagttaa-
- accttggaagaaccaaatc
- accumulated
- accumulating
- accumulation
- accumulations
- accupressure
- accuracies
- accuracy
- accuracy-the
- accurate
- accurate--
- accurate--than
- accurate--to
- accurately
- accuratelymodel
- accurist
- accursed
- accusations
- accused
- accytnarggt
- acd
- ace
- ace-i
- ace-inhibitor
Example sentences for: accurate
How can you use “accurate” in a sentence? Here are some example sentences to help you improve your vocabulary:
As a result, as agencies implement GPRA, they will have to balance the cost of data collection efforts against the need to ensure that the collected data are complete, accurate, and consistent enough to document performance and support decisionmaking at various organizational levels.
Though the WGS sequences contain more gaps than would be considered acceptable for 'finished' sequence, the sequences that are present are highly accurate.
It turns out (if the latest reports are accurate) the dress had been in hiding with Lewinsky's Manhattanite mother, Marcia, who turned it over last week to prosecutors in exchange for immunity.
Correct marker order and intermarker distance are essential for linkage analysis and therefore require construction of accurate physical and genetic maps.
For the 10-minute constant infusion, an accurate determination of both the bolus response function and the input can be obtained when the first venous sample is at 10 minutes (fig.
Loading...