Words similar to accurate
- acctcccaaactatagattgggtg
- acctgcactc
- acctran
- accttattttaaaaataaagttaa-
- accttggaagaaccaaatc
- accumulated
- accumulating
- accumulation
- accumulations
- accupressure
- accuracies
- accuracy
- accuracy-the
- accurate
- accurate--
- accurate--than
- accurate--to
- accurately
- accuratelymodel
- accurist
- accursed
- accusations
- accused
- accytnarggt
- acd
- ace
- ace-i
- ace-inhibitor
Example sentences for: accurate
How can you use “accurate” in a sentence? Here are some example sentences to help you improve your vocabulary:
Friends and colleagues of Jacqueline du Pré have attacked Hilary and Jackie for both its factual distortions and its unflattering depiction of an allegedly generous artist--but I frankly don't care if the picture is accurate or not.
The authors concluded that there was substantial experimental variability in the experimental procedure, necessitating extensive filtering and large numbers of arrays to detect accurate gene expression changes (LUT: look-up tables) [ 20 ] . In our laboratory, we have processed over 1,200 Affymetrix arrays, and have found significantly higher experimental reproducibility (R 2= 0.979 for new generation U74A version 2 murine arrays or human U95 series, see Result and Discussion).
He observes that "the only accurate score is for Alan Keyes, who I would indeed rank dead last."
In addition to simply being a more accurate presentation of scientific knowledge, such quantification could dramatically increase the value of the underlying estimates in several ways.
Placebos have no role to play in the assessment or management of pain outside of clinical trials [ 21 ] . Neither is there rationale for concerns that appropriate doses of analgesics will "mask" signs that will prevent accurate diagnosis and treatment [ 22 23 24 ] .
Loading...