Words similar to accurate
- acctcccaaactatagattgggtg
- acctgcactc
- acctran
- accttattttaaaaataaagttaa-
- accttggaagaaccaaatc
- accumulated
- accumulating
- accumulation
- accumulations
- accupressure
- accuracies
- accuracy
- accuracy-the
- accurate
- accurate--
- accurate--than
- accurate--to
- accurately
- accuratelymodel
- accurist
- accursed
- accusations
- accused
- accytnarggt
- acd
- ace
- ace-i
- ace-inhibitor
Example sentences for: accurate
How can you use “accurate” in a sentence? Here are some example sentences to help you improve your vocabulary:
But everything else is pretty much accurate.
How can we tell whether "recovered memories" are accurate?
In the derivation of LogP (see materials and methods, Figure 7), it is assumed that the statistics of any absent probe can be described by the general background curve B. The P value should not be literally interpreted as accurate probabilities, since it is only as good as the underlining assumption.
To obtain accurate, quantitative information on target gene expression we employed qPCR technology.
Beating the Bounds was intended to establish boundaries at a time when accurate maps were not available.
Loading...