Words similar to accurate
- acctcccaaactatagattgggtg
- acctgcactc
- acctran
- accttattttaaaaataaagttaa-
- accttggaagaaccaaatc
- accumulated
- accumulating
- accumulation
- accumulations
- accupressure
- accuracies
- accuracy
- accuracy-the
- accurate
- accurate--
- accurate--than
- accurate--to
- accurately
- accuratelymodel
- accurist
- accursed
- accusations
- accused
- accytnarggt
- acd
- ace
- ace-i
- ace-inhibitor
Example sentences for: accurate
How can you use “accurate” in a sentence? Here are some example sentences to help you improve your vocabulary:
If sufficiently accurate, such an absolute scale for all array readouts could facilitate comparisons across large, diverse gene expression databases.
It could then be argued that, given the discrete nature of biological sequences, new scale-independent numerical representations, such as USM, are all but the first step in the identification of more accurate Boolean equivalents of fundamental relevance.
But if the story was about the bonanza to the fan, the first number is accurate.
In rare cases, the Comptroller General may grant an extension beyond 30 calendar days if the agency shows that an extension is necessary and will likely result in a more accurate product.
This reduction was obtained through more accurate burden estimates and the elimination of certain requirements including time and temperature reports and personnel resumes of establishment employees.