Words similar to site

Example sentences for: site

How can you use “site” in a sentence? Here are some example sentences to help you improve your vocabulary:

King Prithvi Narayan Shah had difficulty conquering Kirtipur, whose site atop a ridge with two high points made it virtually impregnable.
This places the 5' proviral poly(A) site at the end of an alternative exon that can be utilised to produce fusion transcripts, or excluded to produce wild type transcripts.
When events are identified independently by the CEC, the CEC event rates may be higher, lower, or the same as the site investigator-reported rates.
The European peace movement, for example, has taken -shima from Hiroshima to denote a site of nuclear devastation.
PCR was done to amplify the resultant cDNAs using the GeneRacer 5' primer and a primer consisting of bases immediately upstream of the translation start site of the p27 Kip1gene (CTTTCTCCCGGGTCTGCACGACCG for human and CTTCCTCCTCGGGCGGGTGT for mouse).