Words similar to site-directed

Example sentences for: site-directed

How can you use “site-directed” in a sentence? Here are some example sentences to help you improve your vocabulary:

SZ participated in fura imaging and oocyte experiments and carried out the site-directed mutagenesis.
termed 'radical' site-directed mutagenesis [ 28 ] . This method involves replacing hydrophobic residues with charged residues, or changing charged residues to oppositely charged residues.
Point mutations were introduced by using the QuikChange XL site-directed mutagenesis kit from Stratagene.
Plasmids pB32 and pB86, carrying H109A and H109D alleles of HNT2 , were constructed by site-directed mutagenesis [ 49 ] of plasmid pB05 using primers PB3 (5'ATAATGTGTGTAGCCAAGTGGGGT) and PB4 (5'TAATGTGTGTATCCAAGTGGGGTAC).
Since conventional site-directed mutagenesis requires a DNA template, direct mutational analysis of selected RNA genes is not an option.