Example sentences for: site-directed

How can you use “site-directed” in a sentence? Here are some example sentences to help you improve your vocabulary:

  • These obstacles have been largely circumvented by the use of cloned viral cDNA that is then altered by standard DNA-based site-directed mutagenesis procedures [ 8 9 ] . Originally designed for influenza virus minigenomes [ 10 ] , such cDNA-based "reverse genetics" strategy has been adopted in a large number of NNR viruses, including vesicular stomatitis virus (VSV), respiratory syncytial virus (RSV), and measles, to name a few [ 11 12 13 14 ] . Recently, extension of this approach has resulted in the cloning of full-length viral cDNA capable of producing infectious recombinant virus particles upon transcription.

  • Plasmids pB32 and pB86, carrying H109A and H109D alleles of HNT2 , were constructed by site-directed mutagenesis [ 49 ] of plasmid pB05 using primers PB3 (5'ATAATGTGTGTAGCCAAGTGGGGT) and PB4 (5'TAATGTGTGTATCCAAGTGGGGTAC).

  • Although members of the Ras GTPase superfamily have been studied for many years using site-directed mutagenesis approaches, there have been no previous reports demonstrating cytopathic effects of this kind.

  • To determine which of these potential transcription factor binding sites is responsible for regulating normal CD5 expression, we performed site-directed mutagenesis on the CCAAT (mutC), κE2 (mutK) and Ets (mutE) sites from the StuI B reporter construct.

  • In the RHeoSwitch gene expression system, the properties of the chimeric receptors have been optimized through the analysis of a series of truncation and site-directed mutations (Palli, et.al.


How many words do you know? Try our free vocabulary size test!


Search

Search for example sentences

Loading Loading...
Quantcast