Words similar to site-directed

Example sentences for: site-directed

How can you use “site-directed” in a sentence? Here are some example sentences to help you improve your vocabulary:

These obstacles have been largely circumvented by the use of cloned viral cDNA that is then altered by standard DNA-based site-directed mutagenesis procedures [ 8 9 ] . Originally designed for influenza virus minigenomes [ 10 ] , such cDNA-based "reverse genetics" strategy has been adopted in a large number of NNR viruses, including vesicular stomatitis virus (VSV), respiratory syncytial virus (RSV), and measles, to name a few [ 11 12 13 14 ] . Recently, extension of this approach has resulted in the cloning of full-length viral cDNA capable of producing infectious recombinant virus particles upon transcription.
Plasmids pB32 and pB86, carrying H109A and H109D alleles of HNT2 , were constructed by site-directed mutagenesis [ 49 ] of plasmid pB05 using primers PB3 (5'ATAATGTGTGTAGCCAAGTGGGGT) and PB4 (5'TAATGTGTGTATCCAAGTGGGGTAC).
Although members of the Ras GTPase superfamily have been studied for many years using site-directed mutagenesis approaches, there have been no previous reports demonstrating cytopathic effects of this kind.
To determine which of these potential transcription factor binding sites is responsible for regulating normal CD5 expression, we performed site-directed mutagenesis on the CCAAT (mutC), κE2 (mutK) and Ets (mutE) sites from the StuI B reporter construct.
In the RHeoSwitch gene expression system, the properties of the chimeric receptors have been optimized through the analysis of a series of truncation and site-directed mutations (Palli, et.al.