Words similar to nt
Example sentences for: nt
How can you use “nt” in a sentence? Here are some example sentences to help you improve your vocabulary:
In a seperate reaction, sense primer 5'GGAGAAGTCTGTGATCGCCAAGAAGCTGGA3' was paired with antisense primer (nt 3100 to nt 3081).
It does work on Windows 95 or Windows NT 4.0.)
dNTP, deoxyribonucleoside triphosphate; hnRNP heterogeneous nuclear ribonuclear protein; nt, nucleotide; LTR, long terminal repeat; MEF, mouse embryonic fibroblast; NPT, neomycin phosphotransferase; RT PCR, reverse transcriptase polymerase chain reaction.
I use both commercial software and free software in the course of my work (I'm adminstrator of a large number of NT and Unix computer systems), and it's pretty clear to me that it's the free software that is rigorously tested and the commercial software that gets released just as soon as it appears to run.
A shorter variant contained the intact 3' end of exon 7 and 60 nt of read-through transcription into the ETn element spliced to exon 8 (7+60ETn,8).