Words similar to nt

Example sentences for: nt

How can you use “nt” in a sentence? Here are some example sentences to help you improve your vocabulary:

dNTP, deoxyribonucleoside triphosphate; hnRNP heterogeneous nuclear ribonuclear protein; nt, nucleotide; LTR, long terminal repeat; MEF, mouse embryonic fibroblast; NPT, neomycin phosphotransferase; RT PCR, reverse transcriptase polymerase chain reaction.
In positive controls, A549 cell treated with calcium mobilizers (thapsigargin or A23178) did increase eIF-2 phosphorylation, as has been shown earlier [ 30 ] . These results provide the first direct evidence that the 21-nt long double-stranded siRNAs fail to trigger interferon response in mammalian cells, and hence, can be used as specific antiviral agents.
In a seperate reaction, sense primer 5'GGAGAAGTCTGTGATCGCCAAGAAGCTGGA3' was paired with antisense primer (nt 3100 to nt 3081).
It does work on Windows 95 or Windows NT 4.0.)
The exon structure was confirmed by comparing the cDNA with nucleotide contig NT_009866.