Words similar to hnt
Example sentences for: hnt
How can you use “hnt” in a sentence? Here are some example sentences to help you improve your vocabulary:
A transformant shown to contain the 1976 bp hnt2Δ::kanMX2 product in place of the wild-type 1200 bp HNT2 product was named strain BY16.
In the case of the Hint-homologous HNT1 gene of S. cerevisiae , the phenotype of the single mutant was mild and the biological pathway, positive regulation of Kin28, the yeast homolog of Cdk7, was revealed by synthetic lethal interactions between hnt1 and hypomorphic alleles of cak1 , kin28 , ccl1 and tfb3 [ 9 ] . Because backup systems to limit problems with hnt2 mutant cells apparently exist, synthetic lethal interactions may be critical to identify the Hnt2 biological pathway.
The high levels of ApppN (~100 μM) and AppppN (~10 μM) and the fact that Hnt2-containing samples continue to reduce the rate of increase in dinucleoside polyphosphates without reducing their concentrations demonstrate that heat shock induces dinucleoside polyphosphate synthesis and that Hnt2 is saturated under such conditions.
A 1570 bp DNA fragment containing an hnt2Δ::kanMX2 disruption cassette was generated as described [ 46 ] . Primers 4716 (5'GAAGCTCCATTGATCTATCTTGGGCTCAGAATGATCTTAAGCAAAACAAAGCTTCGTACGCTGCAG) and 4717 (5'CGTAAGTATGAATCTATTATTTATTGAACTATAGTGTTAAACCAGGGCCACTAGTGGATCTGA) were used to amplify the yeast expressible geneticin-resistance gene from pFA6a -kanMX2 [ 46 ] with 50 bp DNA ends corresponding to sequences upstream and downstream of HNT2 . The resulting fragment was transformed into haploid S. cerevisiae strain BY4727, and transformants were selected on YPD with 400 μg/ml geneticin.
As shown in Table 2, strains containing an intact HNT2 gene were never observed to have calculated intracellular ApppN levels above 3 μM and typically were found to have ApppN levels below 1 μM.
Loading...