Words similar to hnt
Example sentences for: hnt
How can you use “hnt” in a sentence? Here are some example sentences to help you improve your vocabulary:
An added benefit of these constructions is the availability of yeast strains that possess high levels of dinucleoside polyphosphates and at the same time express a mutant Fhit-homologous protein, because these are conditions which have been postulated to constitute the signaling form of Fhit [ 16 ] . Finally, using controlled genotypes we revisited conditions that lead to increased accumulation of dinucleoside polyphosphates [ 24 25 26 27 28 29 30 31 32 33 ] . Recognizing that hnt2 deletion is a pathological condition, we were particular interested in identifying conditions that lead to accumulation of such compounds in cells that contain a functional HNT2 gene, rather than simply identifying conditions that produce diadenosine polyphosphate accumulation in the absence of Hnt2.
Markers segregated 2:2 in nearly all cases and possession of a 1976 bp PCR fragment using primers 4726 and 4722 always correlated with geneticin-resistance while possession of a 1200 bp product correlated with geneticin-sensitivity, as expected for segregants containing a nondisrupted HNT2 gene.
In the case of the Hint-homologous HNT1 gene of S. cerevisiae , the phenotype of the single mutant was mild and the biological pathway, positive regulation of Kin28, the yeast homolog of Cdk7, was revealed by synthetic lethal interactions between hnt1 and hypomorphic alleles of cak1 , kin28 , ccl1 and tfb3 [ 9 ] . Because backup systems to limit problems with hnt2 mutant cells apparently exist, synthetic lethal interactions may be critical to identify the Hnt2 biological pathway.
A 1570 bp DNA fragment containing an hnt2Δ::kanMX2 disruption cassette was generated as described [ 46 ] . Primers 4716 (5'GAAGCTCCATTGATCTATCTTGGGCTCAGAATGATCTTAAGCAAAACAAAGCTTCGTACGCTGCAG) and 4717 (5'CGTAAGTATGAATCTATTATTTATTGAACTATAGTGTTAAACCAGGGCCACTAGTGGATCTGA) were used to amplify the yeast expressible geneticin-resistance gene from pFA6a -kanMX2 [ 46 ] with 50 bp DNA ends corresponding to sequences upstream and downstream of HNT2 . The resulting fragment was transformed into haploid S. cerevisiae strain BY4727, and transformants were selected on YPD with 400 μg/ml geneticin.
While Dcps enzymes are specific for hydrolysis of cap structures such as 7meGpppG [ 28, 29], prototypical Hint enzymes such as rabbit Hint and yeast Hnt1 hydrolyze adenosine 5'-monophosphoramide substrates such as AMP-lysine to AMP plus lysine [ 30].
Loading...