Example sentences for: hnt

How can you use “hnt” in a sentence? Here are some example sentences to help you improve your vocabulary:

  • In contrast, hnt2ΔADE2 strains achieved a 3.7-fold higher level of AppppN than HNT2 ADE2 strains.

  • The ade2 mutation was partially epistatic to the effect of hnt2 disruption on ApppN accumulation.

  • hnt2Δ strains containing ade2 mutations were several fold lower in ApppN accumulation than hnt2ΔADE2 isolates.

  • A 1570 bp DNA fragment containing an hnt2Δ::kanMX2 disruption cassette was generated as described [ 46 ] . Primers 4716 (5'GAAGCTCCATTGATCTATCTTGGGCTCAGAATGATCTTAAGCAAAACAAAGCTTCGTACGCTGCAG) and 4717 (5'CGTAAGTATGAATCTATTATTTATTGAACTATAGTGTTAAACCAGGGCCACTAGTGGATCTGA) were used to amplify the yeast expressible geneticin-resistance gene from pFA6a -kanMX2 [ 46 ] with 50 bp DNA ends corresponding to sequences upstream and downstream of HNT2 . The resulting fragment was transformed into haploid S. cerevisiae strain BY4727, and transformants were selected on YPD with 400 μg/ml geneticin.

  • An earlier report demonstrated that disruption of HNT2 was tolerated by haploid yeast strains without an effect on growth and that ApppN and AppppN accumulate 30 and 3-fold, respectively on account of the hnt2 deletion [ 13 ] . Because those data were obtained by random spore analysis, we considered it important to test whether elevated dinucleoside polyphosphate levels co-segregate with hnt2 disruption in all tetrads examined and whether any other commonly used genetic markers affect dinucleoside polyphosphate levels.


How many words do you know? Try our free vocabulary size test!


Search

Search for example sentences

Loading Loading...
Quantcast