Words similar to ho

Example sentences for: ho

How can you use “ho” in a sentence? Here are some example sentences to help you improve your vocabulary:

The paper's coverage has generally been clear in attributing the Wen Ho Lee-probably-did-it line to particular (named and unnamed) government sources.
To generate a restriction-free region at the 5' side of the cDNA cloning site (EcoR I-Xho I) a 860 bp long PCR fragment of human genomic DNA (primers: CCCCAAGCTTGAGTATGAACAAATTTACTTTCTTCTTTC and CCGGCGCGCCTCCTAAAGTGCTGGATTATAG) devoid of Alu I, Dpn I, Dde I, Hinf I and Rsa I was inserted between the Hind III and Asc I site of the vectors.
Ho.
As Benjamin Schwarz and Christopher Layne have written: "Just as Yugoslav President Slobodan Milosevic was not deterred by U.S. action against Iraq; Saddam Hussein was not deterred by U.S. action in Panama, Manuel Antonio Noriega was not deterred by U.S. action in Grenada, Lebanon and Vietnam; Ho Chi Minh was not deterred by U.S. action against North Korea; and Kim Il Sung and Joseph Stalin were not deterred by U.S. action against Adolf Hitler."
The LAT offers a sneak preview of Wen Ho Lee's defense against charges that he committed espionage at the Los Alamos nuclear facility.