Example sentences for: dna

How can you use “dna” in a sentence? Here are some example sentences to help you improve your vocabulary:

  • The 481 bp DNA fragment was labeled and used essentially as described for the PPT1 probe.

  • Cytoplasmic DNA isolation and analysis

  • DNA carrying the wildtype syk coding region was generated by polymerase chain reaction (PCR) using high fidelity polymerase (Perkin Elmer, Branchburg, NJ) forward- 5'gacacctgccgaggtgtgtg 3'and reverse 5'gagggaggtggctgacaatc 3'primers, and random-primed cDNA template derived from the human Burkitt's lymphoma cell line, Daudi.

  • Spotting of amplified cDNAs onto glass is another method commonly used to fabricate arrays [ 15 ] . Interestingly, multi-stranded DNA structures have been found to form on the surface of such arrays [ 16 ] . Furthermore, a low concentration of amplified cDNA in the dispense plate can generate a compression in the expression ratios, underscoring the importance of this parameter [ 15 ] . Although PCR preparation is not a factor in the fabrication of oligodeoxyribonucleotide arrays, a similar problem exists, namely, surface probe density.

  • More recent DNA sequence information can be combined with these classical data to make inferences about phylogeny and species divergence.


How many words do you know? Try our free vocabulary size test!


Search

Search for example sentences

Loading Loading...
Quantcast