Words similar to disruption
Example sentences for: disruption
How can you use “disruption” in a sentence? Here are some example sentences to help you improve your vocabulary:
[ 22 ] demonstrated, by targeted disruption of the mouse alphaA gene, that this protein was essential for the maintenance of lens transparency, possibly by maintaining the solubility of alphaB, or associated proteins, in the lens.
For surely,Nothing can so disturb the passions, or Perplex the intellects of man so much,As the disruption of this union withVisible nature, separation from allThat has delighted or engaged him, a changeNot only of the place but of the mannerOf his being, an entrance into a state Not simply which he knows not, but perhapsA state he has not faculties to know."
The most interesting part of the discussion focused on "why the disruption?"
Disruption of the countin gene results in extremely large mounds and fruiting bodies [ 13 ] . As noted above, one of the phenotypes associated with disruption of the ifkA gene was large aggregates and fruiting bodies, and these aberrations appeared to result from a secreted factor(s).
A 1570 bp DNA fragment containing an hnt2Δ::kanMX2 disruption cassette was generated as described [ 46 ] . Primers 4716 (5'GAAGCTCCATTGATCTATCTTGGGCTCAGAATGATCTTAAGCAAAACAAAGCTTCGTACGCTGCAG) and 4717 (5'CGTAAGTATGAATCTATTATTTATTGAACTATAGTGTTAAACCAGGGCCACTAGTGGATCTGA) were used to amplify the yeast expressible geneticin-resistance gene from pFA6a -kanMX2 [ 46 ] with 50 bp DNA ends corresponding to sequences upstream and downstream of HNT2 . The resulting fragment was transformed into haploid S. cerevisiae strain BY4727, and transformants were selected on YPD with 400 μg/ml geneticin.
Loading...