Words similar to cycle

Example sentences for: cycle

How can you use “cycle” in a sentence? Here are some example sentences to help you improve your vocabulary:

There is, instead, an endless cycle of creation, destruction, and rebirth.
In cultured cells, C/EBPα expression leads to decreased colony formation upon antibiotic selection [ 23 24 25 ] , decreased DNA synthesis [ 22 24 25 26 27 ] and an enhanced proportion of cells in the G1 phase of the cell cycle [ 26 ] . Thus, C/EBPα regulates cellular proliferation, as well as gene transcription.
Cell-cycle DNA content assays by FCM suggest that NOM enhances the blocking activity of ADR on the cell cycle.
By now, it is barely producing a pulse, except among Jews who are within one generation of the immigration cycle.
cDNA was resuspended in 20 ul water and used in a 30-cycle PCR reaction with 1 uM of each of the following four primers: {CCACGCTGTTTTGACCTCCATAGAAGACAC, CACATAGTCCCCCAGAAAGAGGTAGTTGCT}, in which product only forms from 6His-HA-PP1α cDNA, and {GACGCGGGCAAGCAGTCCCTCGAGACCATTGCCTGCTG, CTGGAGACCCACGACCTGGCCTGCCGTTG}, in which product only forms from endogenous PP1α cDNA.